Skip to main content
. 2020 Aug 27;9:e58331. doi: 10.7554/eLife.58331

Key resources table.

Reagent type
(species) or resource
Designation Source or reference Identifiers Additional information
Genetic reagent (Mus. Musculus) C57BL/6 background Jackson Laboratories WT (8–19 weeks old)
Genetic reagent (Mus. Musculus) Mef2cf/f(C57BL/6J background) Arnold et al., 2007; PMID:17336904 RRID:MGI:3719006 Mef2cf/f(8–19 weeks old): knock-in of loxP sites flanking exon 11 of the Mef2c gene, a control for the Mef2c-cKOCamk2a-Cre
Genetic reagent (Mus. Musculus) C57BL/6 background,
B6.Cg- Tg(Camk2a-Cre)T29-1Stl/J
Jackson Laboratories Mef2c-cKOCamk2a-Cre (8–19 weeks old): CRE-mediated recombination of the Mef2cf/floxP sites, resulting in a region and cell type specific conditional knockout Mef2c-cKOCamk2a-Cre
Genetic reagent (Mus. Musculus) Mef2c+/- (backcrossed to C57BL/6J) Harrington et al., 2020. PMID:32418612.
Antibody Anti-MEF2C (Mouse, Monoclonal) Novus Cat. # NBP2-00493 Immunoprecipitation (2 ul (ug) per sample)
Antibody anti-MEF2C
(Rabbit, Monoclonal)
Abcam Cat. #: ab197070; RRID:AB_2629454 (1:2500) (WB)
Antibody anti-phospho-MEF2
(Rabbit, Polyclonal)
Phospho-peptide affinity purified in-house (as described in Flavell et al., 2006. PMID:16484497) (1:200) (WB)
Antibody Anti-beta-actin (Rabbit, Monoclonal) Cell Signaling Cat. #: 4970S RRID:AB_2223172 (1:1000) (WB)
Antibody IRDye 800CW Goat anti-Rabbit IgG Secondary Antibody Li-Cor Cat. #: 926–32211 (1:20,000) (WB after IP)
Sequence-based reagent Mef2C KO F1 This paper
(GGGAACCTGACAAATGTGGG)
PCR Primers Products of 2 kb for non-recombined Mef2cf/fand 1 kb for recombined Mef2c-cKOCamk2a-Cre alleles
Sequence-based reagent Mef2C KO R2 This paper
(GTGCATGGCACAGACTACTAGC)
PCR Primers
Commercial assay or kit RNeasy mini kit Qiagen Cat. #. 74104 RNA purification
Commercial assay or kit TrueSeq Stranded mRNA Library Prep Illumina Cat. #. 20020596 RNA-seq library preparation
Commercial assay or kit Agilent Bioanalyzer High-Sensitivity DNA chip Agilent Cat. #. 5067–1504
Commercial assay or kit DC Protein Assay Kit II Bio-Rad Cat. #: 5000112
Commercial assay or kit 7.5% Mini-PROTEAN TGX Stain-Free Protein Gels, 15 well, 15 µl Bio-Rad Cat.#: 4568026 WB after IP
Commercial assay or kit Trans-Blot Turbo Midi PVDF Transfer Packs Bio-Rad Cat. #: 1704157 WB after IP
Commercial assay or kit Odyssey blocking buffer Li-Cor Cat. #: NC9877369 WB after IP
Chemical compound, drug TRIzol reagent Thermo Fisher Scientific Cat. #. 15596026 RNA extraction
Software, algorithm GraphPad Prism GraphPad Prismhttps://graphpad.com
Software, algorithm FASTQC Babraham Bioinformaticshttps://www.bioinformatics.babraham.ac.uk/projects/fastqc
Software, algorithm Trimmomatic Bolger et al., 2014
Software, algorithm STAR Dobin et al., 2013
Software, algorithm R R Foundationhttps://www.r-project.org
Software, algorithm HTSeq Anders et al., 2015 R package
Software, algorithm edgeR McCarthy et al., 2012
Robinson et al., 2010
R package
Software, algorithm DESeq2 Anders and Huber, 2010
Love et al., 2014
R package
Software, algorithm UpSetR Conway et al., 2017 R package
Software, algorithm WGCNA Weighted gene co-expression network analysis
Langfelder and Horvath, 2008
R package
Software, algorithm DEXseq Anders et al., 2012 R package
Software, algorithm ToppGene Chen et al., 2009
https://toppgene.cchmc.org
Web-tool
Software, algorithm REVIGO http://revigo.irb.hr
Supek et al., 2011
Web-tool
Other Single-cell RNA-seq Dataset Mouse visual cortex single cell RNA-seq dataset
Hrvatin et al., 2018
NCBI GEO: GSE102827
Other Protein G Plus/A agarose beads Millpore Sigma IP05 Immunoprecipitation (75 ul per sample)