Key resources table.
| Reagent type (species) or resource |
Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Genetic reagent (Mus. Musculus) | C57BL/6 background | Jackson Laboratories | WT (8–19 weeks old) | |
| Genetic reagent (Mus. Musculus) | Mef2cf/f(C57BL/6J background) | Arnold et al., 2007; PMID:17336904 | RRID:MGI:3719006 | Mef2cf/f(8–19 weeks old): knock-in of loxP sites flanking exon 11 of the Mef2c gene, a control for the Mef2c-cKOCamk2a-Cre |
| Genetic reagent (Mus. Musculus) | C57BL/6 background, B6.Cg- Tg(Camk2a-Cre)T29-1Stl/J |
Jackson Laboratories | Mef2c-cKOCamk2a-Cre (8–19 weeks old): CRE-mediated recombination of the Mef2cf/floxP sites, resulting in a region and cell type specific conditional knockout Mef2c-cKOCamk2a-Cre | |
| Genetic reagent (Mus. Musculus) | Mef2c+/- (backcrossed to C57BL/6J) | Harrington et al., 2020. PMID:32418612. | ||
| Antibody | Anti-MEF2C (Mouse, Monoclonal) | Novus | Cat. # NBP2-00493 | Immunoprecipitation (2 ul (ug) per sample) |
| Antibody | anti-MEF2C (Rabbit, Monoclonal) |
Abcam | Cat. #: ab197070; RRID:AB_2629454 | (1:2500) (WB) |
| Antibody | anti-phospho-MEF2 (Rabbit, Polyclonal) |
Phospho-peptide affinity purified in-house (as described in Flavell et al., 2006. PMID:16484497) | (1:200) (WB) | |
| Antibody | Anti-beta-actin (Rabbit, Monoclonal) | Cell Signaling | Cat. #: 4970S RRID:AB_2223172 | (1:1000) (WB) |
| Antibody | IRDye 800CW Goat anti-Rabbit IgG Secondary Antibody | Li-Cor | Cat. #: 926–32211 | (1:20,000) (WB after IP) |
| Sequence-based reagent | Mef2C KO F1 | This paper (GGGAACCTGACAAATGTGGG) |
PCR Primers | Products of 2 kb for non-recombined Mef2cf/fand 1 kb for recombined Mef2c-cKOCamk2a-Cre alleles |
| Sequence-based reagent | Mef2C KO R2 | This paper (GTGCATGGCACAGACTACTAGC) |
PCR Primers | |
| Commercial assay or kit | RNeasy mini kit | Qiagen | Cat. #. 74104 | RNA purification |
| Commercial assay or kit | TrueSeq Stranded mRNA Library Prep | Illumina | Cat. #. 20020596 | RNA-seq library preparation |
| Commercial assay or kit | Agilent Bioanalyzer High-Sensitivity DNA chip | Agilent | Cat. #. 5067–1504 | |
| Commercial assay or kit | DC Protein Assay Kit II | Bio-Rad | Cat. #: 5000112 | |
| Commercial assay or kit | 7.5% Mini-PROTEAN TGX Stain-Free Protein Gels, 15 well, 15 µl | Bio-Rad | Cat.#: 4568026 | WB after IP |
| Commercial assay or kit | Trans-Blot Turbo Midi PVDF Transfer Packs | Bio-Rad | Cat. #: 1704157 | WB after IP |
| Commercial assay or kit | Odyssey blocking buffer | Li-Cor | Cat. #: NC9877369 | WB after IP |
| Chemical compound, drug | TRIzol reagent | Thermo Fisher Scientific | Cat. #. 15596026 | RNA extraction |
| Software, algorithm | GraphPad Prism | GraphPad Prismhttps://graphpad.com | ||
| Software, algorithm | FASTQC | Babraham Bioinformaticshttps://www.bioinformatics.babraham.ac.uk/projects/fastqc | ||
| Software, algorithm | Trimmomatic | Bolger et al., 2014 | ||
| Software, algorithm | STAR | Dobin et al., 2013 | ||
| Software, algorithm | R | R Foundationhttps://www.r-project.org | ||
| Software, algorithm | HTSeq | Anders et al., 2015 | R package | |
| Software, algorithm | edgeR |
McCarthy et al., 2012
Robinson et al., 2010 |
R package | |
| Software, algorithm | DESeq2 |
Anders and Huber, 2010
Love et al., 2014 |
R package | |
| Software, algorithm | UpSetR | Conway et al., 2017 | R package | |
| Software, algorithm | WGCNA | Weighted gene co-expression network analysis Langfelder and Horvath, 2008 |
R package | |
| Software, algorithm | DEXseq | Anders et al., 2012 | R package | |
| Software, algorithm | ToppGene |
Chen et al., 2009
https://toppgene.cchmc.org |
Web-tool | |
| Software, algorithm | REVIGO |
http://revigo.irb.hr
Supek et al., 2011 |
Web-tool | |
| Other | Single-cell RNA-seq Dataset | Mouse visual cortex single cell RNA-seq dataset Hrvatin et al., 2018 |
NCBI GEO: GSE102827 | |
| Other | Protein G Plus/A agarose beads | Millpore Sigma | IP05 | Immunoprecipitation (75 ul per sample) |