Key resources table.
| Reagent type (species) or resource |
Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Gene (Mus musculus) | H3.4 histone (H3t) | GenBank | 382523 | |
| Gene (Homo sapiens) | PHF1 | GenBank | 5252 | |
| Strain, strain background (Escherichia coli) | BL21(DE3) | Thermo Fisher | C600003 | |
| Cell line (Homo sapiens) | 293T/17 | ATCC | CRL-11268 | |
| Antibody | Anti-histone H3 (rabbit polyclonal) | abcam | ab1791 | WB (1:2000) |
| Antibody | Anti-histone H3t (mouse monoclonal) | This paper Ueda et al., 2017 | WB (1:1000) IF (1:1000) |
|
| Antibody | Anti-PHF1 (rabbit polyclonal) | Abcam | Cat# ab80042 | IF (1:500) |
| Antibody | Anti-SCP3 (mouse monoclonal) | Abcam | 10G11/7 Cat# ab97672 |
IF (1:1000) |
| Antibody | Anti-γ H2A.X (mouse monoclonal) | Merck Millipore | Cat# #05–636 | IF (1:1000) |
| Antibody | Lectin PNA tagged with Alexa Fluor 488 | Thermo Fisher | Cat# L21409 | IF (1:1000) |
| Sequence-based reagent | Eef1a1–Fw | Ueda et al., 2017 | PCR primers | CTCTGACTACCCTCCACTTGGTCG |
| Sequence-based reagent | Eef1a1–Rev | Ueda et al., 2017 | PCR primers | ATTAAGACTGGGGTGGCAGGTGTT |
| Sequence-based reagent | Phf1–Fw | This paper | PCR primers | TGAGAAGTGTCGCCATGCTTA |
| Sequence-based reagent | Phf1–Rev | This paper | PCR primers | CATAGGGACCTTTCTTCAGTGC |
| Recombinant DNA reagent | pET28-MHL | SGC, Toronto | 26096 (Genbank accession number: EF456735) | Expression of the Tudor domains of PHF1, MTF2 and PHF19, and their mutants |
| Software, algorithm | Origin 6.1, Origin 7.0 | OriginLab | http://www.originlab.com/ | For ITC curve fitting and calculation of Kd values |
| Software, algorithm | XDS | PMID:20124692 | http://xds.mpimf-heidelberg.mpg.de/ | Processing of X-ray diffraction data |
| Software, algorithm | Pymol | DeLano Scientific LLC | http://www.pymol.org/ | Drawing structure figures |
| Software, algorithm | Coot | PMID:15572765 | http://www2.mrc-lmb.cam.ac.uk/Personal/pemsley/coot/ | Structure model building |
| Software, algorithm | CCP4 | PMID:21460441 | https://www.ccp4.ac.uk/ | Structure determination and refinement |
| Software, algorithm | MASCOT program | Matrix Science | Version 2.6 | |
| Software, algorithm | Proteome discoverer 2.2 | Thermo Fisher | ||
| Other | Hoechst 33342 | Thermo Fisher | Cat# H3570 | IF (1:5000) |