Table 3.
Details of nks_bad2 gene based SSR marker for aroma
| Marker | Primer Sequences | Tm | PB1121 Allele | Robin Allele | Position (Mb) |
|---|---|---|---|---|---|
| nks_bad2 | F: GGTTGCATTTACTGGGAGTTATG | 58 °C | 82 bp | 90 bp | Gene based |
| R: TCCACAGAAATTTGGAAACAAA |
Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.