Antibodies |
|
Anti-CD11c AF488 (Lineage) |
BioLegend |
301618; RRID: AB_439791
|
Anti-CD14 FITC (Lineage) |
BD Bioscience |
555397; RRID: AB_395798
|
Anti-CD19 FITC (Lineage) |
BD Bioscience |
560994; RRID: AB_10563406
|
Anti-CD3 AF488 (Lineage) |
BioLegend |
300320; RRID: AB_493691
|
Anti-CD4 FITC (Lineage) |
BioLegend |
317420; RRID: AB_571939
|
Anti-TCRgd AF488 (Lineage) |
BioLegend |
331208; RRID: AB_1575108
|
Anti-TCRab AF488 (Lineage) |
BioLegend |
306712; RRID: AB_528967
|
Anti-CD34 FITC (Lineage) |
BioLegend |
343604; RRID: AB_1732005
|
Anti-CD303 FITC (Lineage) |
BioLegend |
354208; RRID: AB_2561364
|
Anti-CD19 FITC (Lineage) |
BD Bioscience |
560994; RRID: AB_10563406
|
Anti-CD94 PerCp.Cy5.5 |
BD Bioscience |
562361; RRID: AB_11152081
|
Anti-CD117 BV421 |
BioLegend |
313216; RRID: AB_11148721
|
Anti-CD117 BV650 |
BioLegend |
313221; RRID: AB_2562714
|
Anti-CD161 BV605 |
BioLegend |
339915; RRID: AB_11142679
|
Anti-CD16 BV650 |
BioLegend |
302042; RRID: AB_2563801
|
Anti-CD56 BV711 |
BioLegend |
318336; RRID: AB_2562417
|
Anti-CD3 BV785 |
BioLegend |
317330; RRID: AB_2563507
|
Anti-CD294 AF647 |
BD Bioscience |
558042; RRID: AB_2112699
|
Anti-CD38 AF700 |
BioLegend |
303516; RRID: AB_2072782
|
Anti-CD95 PE-CF594 |
BioLegend |
305634; RRID: AB_2564221
|
Anti-CD127 Pe-Cy7 |
Beckman Coulter |
A14934; RRID: AB_2534372
|
Anti-CD4 BUV496 |
BD Bioscience |
564651; RRID: AB_2744422
|
Anti-PD-1 BV421 |
BD Bioscience |
562516; RRID: AB_11153482
|
Anti-CD103 BV605 |
BioLegend |
350218; RRID: AB_2564283
|
Anti-CD69 BV785 |
BioLegend |
310932; RRID: AB_2563696
|
Anti-CD3 PE-CF594 |
BD Bioscience |
562280; RRID: AB_11153674
|
Anti-CD366 (NKp44) PE-Cy5 |
Beckman Coulter |
A66903; RRID: AB_2857937
|
Anti-CD8 BUV396 |
BD Bioscience |
563795; RRID: AB_2722501
|
Anti-CD19 BUV496 |
BD Bioscience |
564655; RRID: AB_2744311
|
Live/Dead Fixable Near-IR Dead Cell Stain Kit, 633nm |
Invitrogen |
L10119 |
Anti-IL-2 BV650 |
BD Bioscienceces |
563467; RRID: AB_2738224
|
Anti-IL-4 FITC |
BioLegend |
500807; RRID: AB_315126
|
Anti-IL-5 APC |
BioLegend |
504305; RRID: AB_315329
|
Anti-IL-13 BV421 |
BioLegend |
561158; RRID: AB_10561838
|
Anti-TNFa AFlour700 |
BD Bioscience |
557996; RRID: AB_396978
|
Anti-IFNg PE-Cy7 |
BD Bioscience |
557643; RRID: AB_396760
|
Anti-CD294 (CTRH2) PE-CF594 |
BD Bioscience |
563501; RRID: AB_2738244
|
Anti-CD127 PE-Cy5 |
Beckman Coulter |
A64617; RRID: AB_2833010
|
|
Biological Samples |
|
Human peripheral blood mononuclear cells (PBMCs) |
Human |
Cohorts |
Human tonsil mononuclear cells (TMCs) |
Human |
Cohorts |
(See Table 1) |
|
|
|
Chemicals, Peptides, and Recombinant Proteins |
|
Maxima H-RT and Buffer |
ThermoFisher Scientific |
EP0751 |
dNTPs |
New England Biolabs |
N0447L |
SUPERase∗In RNase inhibitor |
ThermoFisher Scientific |
AM2696 |
Betaine solution, 5M, PCR Reagent |
Millipore Sigma |
B0300-5VL |
KAPA 2x HiFi HotStart PCR mix |
Kapa Biosystems |
KK2602 |
RNAClean XP |
Beckman Coulter |
A63987 |
AMPure XP |
Beckman Coulter |
A63881 |
Nextera XT Kit |
Illumina, Inc |
FC-131-1096 |
|
Oligonucleotides |
|
SMART Oligo dT |
IDT |
/5Biosg/AAGCAGTGGTATCAACGCAGAGTAC(T)30VN |
Template-Switching Oligo |
IDT |
AAGCAGTGGTATCAACGCAGAGTACATrGrGrG |
SMART PCR Primer |
IDT |
AAGCAGTGGTATCAACGCAGAGT |
|
Software and Algorithms |
|
FlowJo |
TreeStar |
v9.9.6 |
Prism |
GraphPad Software |
v8.4.3 |
DESeq2 |
Li and Dewey, 2011 |
V1.18.1 |
Ingenuity Pathway Analysis |
QIAGEN Inc. |
Winter 2019 Release |