Table 1.
Analyzed polymorphisms in genes encoding ERβ and their functional significance
| rs number | Location of polymorphism | Base exchange | Published data | Forward primer (5′–3′) Reverse primer (5′–3′) |
MAFa |
|---|---|---|---|---|---|
| rs1271572 | Promoter chromosome 14:64295199 | C > A | Associated with breast and prostate cancer risk (J Biomed Sci 2013;20:32; Cancer Res 2000;60:702) T/T genotype inhibits ESR2 expression (J Biomed Sci 2013;20:32) |
GCAGCTGTTGCTGATGAAAA CCCCCTCGTCTTCCTCTATT |
0.46 |
| rs2978381 | Promoter chromosome 14:64299934 | T > C | Associated with colorectal cancer survival (Cancer Res 2013;73:767) | GCCAGGATCTCTGCATTCTC AGGCTGAGGAAGCACTTGAC |
0.50 |
| rs3020443 | Promoter chromosome 14:64325622 | T > G | Associated with colorectal cancer survival (Cancer Res 2013;73:767) | GGAGAAAAAGGTTTAGGATGTGA TTATCAGTGGACCCATGCAA |
0.19 |
Abbreviation: MAF, Minor allele frequency.
a
Frequency from Ensemble database: http://www.ensembl.org/index.html.