TABLE 1.
Primer sequences for allele‐specific amplification and sequencing of the mutant ABO gene
| Primer name | Sequence (5′ to 3′) | Purpose | Size of PCR product |
|---|---|---|---|
| ABO_In1_12797_Amp_F*5 | GATCTGGACTGGGTTTGGAG | Allele‐specific amplification and sequencing of Fragment 1 | 655 bp |
| ABO_In2_437C/T_R* | CGCCACCAGTGCCTTGG/A | Allele‐specific amplification and sequencing of Fragment 1 | |
| ABO_In2_437C/T_F† | CCTCAGGGACTGCACTGAC/T | Allele‐specific amplification and sequencing of Fragment 2 | 6152 bp |
| ABO_Ex7_Amp_R† 5 | CCTAGGCTTCAGTTACTCAC | Allele‐specific amplification and sequencing of Fragment 2 | |
| ABO_Ex3_R | GGTCAAGGCTGACTCCAG | Sequencing of Fragment 2 | |
| ABO_Int3_88F | CCGCTCTCTATGCTCTGCCC | Sequencing of Fragment 2 | |
| ABO_Int3_1243R | GTTGCAGTCTGAGGTCTACGTTC | Sequencing of Fragment 2 | |
| ABO_Ex4_F | TTCGACGTGTCTGGTGAATGTGT | Sequencing of Fragment 2 | |
| ABO_Ex4_R | TCAAAACTGAAGCTCCAGCTCCAT | Sequencing of Fragment 2 | |
| ABO_Int4_138F | CAGTCTCTACCCTGACTTGGC | Sequencing of Fragment 2 | |
| ABO_Int4_778R | GCTGCACAGCAATGTGAATGGACT | Sequencing of Fragment 2 | |
| ABO_Int4_1447R | GCCATTGCTTTCCACTTGACTT | Sequencing of Fragment 2 | |
| ABO_Ex5_F1 | TGAGACACAACCCCTTACGTCCC | Sequencing of Fragment 2 | |
| ABO_In5_193R | AAGAGACGCAAGTCAGAGAAAG | Sequencing of Fragment 2 | |
| ABO_Ex6_F | TGAGTGGAGTTTCCAGGTGGG | Sequencing of Fragment 2 | |
| ABO_In6_223R | GCCTCTGGAGAAGGAGCT | Sequencing of Fragment 2 | |
| ABO_In6_942R | CAGATGCACCACGTTCTCC | Sequencing of Fragment 2 | |
| ABO_Ex7_F1 | CATCGCTGGGAAGAGGATGAAGTG | Sequencing of Fragment 2 | |
| ABO_Ex7_720R | GCTGCTTCCGTAGAAG | Sequencing of Fragment 2 | |
| ABO_Ex7_506F | AGCTGTCAGTGCTGGAG | Sequencing of Fragment 2 | |
| ABO_Ex1_Pro_F‡ | GGCGCCGTCCCTTCCTAG | Amplification and sequencing | 266 bp |
| ABO_Ex1_Pro_R‡ | ATTCCCTGCGGTAGCGGCT | Amplification and sequencing |
The ABO gene region including Exon 2 to Exon 7 was analyzed by allele‐specific amplification and direct sequencing of two fragments. Exon 1 and the promotor region were investigated by sequencing of genomic amplification products. Employed forward (F) and reverse (R) primers, and the size of PCR products with control template (genotype A1/O1) using the respective primer pairs (*, †, ‡) are described. The primers used for the allele‐specific amplifications differ by polymorph bases on the last nucleotide position at the 3′ end (indicated in bold print). bp = base pairs.