Key resources table.
| Reagent type (species) or resource |
Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Antibody | Rabbit polyclonal anti-FLAG | Sigma | F7425 RRID:AB_439687 | (1:1000) |
| Antibody | Rabbit polyclonal anti-phospho-Erk1/2 | Cell signaling | 9101S RRID:AB_331646 | (1:2000) |
| Antibody | Mouse monoclonal anti-Erk1/2 | Cell signaling | 4694S | (1:2000) |
| Antibody | Mouse monoclonal anti-FLAG (M2) | Sigma | F1804 RRID:AB_262044 | (1:1000) |
| Antibody | Mouse monoclonal anti-HA (16B12) | Covance | MMS-101R-200 RRID:AB_291263 | (1:2000) |
| Antibody | Mouse monoclonal anti-hexa-histidine tag | Qiagen | 34650 RRID:AB_2687898 | (1:500) |
| Antibody | Mouse monoclonal anti-GFP (B-2) | Santa Cruz Biotechnology | Sc-9996 | (1:1000) |
| Antibody | Mouse monoclonal anti-Tom20 (F-10) | Santa Cruz Biotechnology | sc-17764 RRID:AB_628381 | (1:1000) |
| Antibody | Mouse monoclonal anti-Cytochrome P450 reductase | Santa Cruz Biotechnology | sc-25270 RRID:AB_627391 | (1:2000) |
| Antibody | Mouse monoclonal anti-Cytochrome c | BD Pharmingen | 556433 RRID:AB_396417 | (1:1000) |
| Antibody | Mouse monoclonal anti-ß-actin | MBL | M177-3 | (1:2000) |
| Antibody | Goat polyclonal anti-lactate dehydrogenase | Rockland | 110–1173 | (1:1000) |
| Antibody | Donley anti-Rabbit IgG, HRP-linked F(ab')2 fragment | GE Healthcare | NA9340 RRID:AB_772191 | (1:4000) |
| Antibody | Sheep anti-Mouse IgG, HRP-linked whole Antibody | GE Healthcare | NA931 RRID:AB_772210 | (1:4000) |
| Antibody | Goat anti-Rabbit IgG (H+L) Secondary Antibody, Alexa Fluor 488 | Invitrogen | A11034 RRID:AB_2576217 | (1:10000) |
| Antibody | Goat anti-Guinea Pig IgG (H+L) Secondary Antibody, Alexa Fluor 568 | Invitrogen | A11075 RRID:AB_141954 | (1:10000) |
| Cell line (C. griseus) | CHO-K1 | Tsukamoto et al., 1990 | ||
| Cell line (C. griseus) | pex14 ZP161 | Shimizu et al., 1999 | A PEX14-deficient CHO mutant | |
| Cell line (C. griseus) | ZP161 stably expressing His-RnPEX14 WT (WT-6) | This paper | A stable cell line of ZP161 expressing Pex14-WT | |
| Cell line (C. griseus) | ZP161 stably expressing His-RnPEX14 S232A (SA-13) | This paper | A stable cell line of ZP161 expressing Pex14-S232A | |
| Cell line (C. griseus) | ZP161 stably expressing His-RnPEX14 S232D (SD-30) | This paper | A stable cell line of ZP161 expressing Pex14-S232D | |
| Cell line (R. norvegicus) | Fao | Motojima et al., 1994 | ||
| Cell line (R. norvegicus) | RCR-1 | Abe et al., 2020 | ||
| Cell line (H. sapiens) | HuH-7 | RIKEN | RCB1366 | |
| Cell line (H. sapiens) | HeLa | Yagita et al., 2013 | ||
| Cell line (H. sapiens) | HepG2 | Honsho et al., 2017 | ||
| Cell line (M. musculus) | MEF | Itoyama et al., 2013 | ||
| Transfected construct (R. norvegicus) | siRNA to ERK2 | Sigma-Aldrich | SASI_Rn01_00107866 | GUAUAUACAUUCAGCUAAU |
| Recombinant DNA reagent | MISSION siRNA Universal Negative Control #1 | Sigma-Aldrich | SIC001 | |
| Recombinant DNA reagent | pCMVSPORT/His-RnPEX14 WT (plasmid) | Itoh and Fujiki, 2006 | His-Pex14 WT | |
| Recombinant DNA reagent | pCMVSPORT/His-RnPEX14 SA or SD variants (plasmid) | This paper | His-Pex14 S232A, S232D, S247/252A, S247/252D, S232/247/252A, S232/247/252D | |
| Recombinant DNA reagent | pcDNAZeo-D (plasmid) | This paper | A mammalian expression vector with low transcription | |
| Recombinant DNA reagent | pcDNAZeo-D/His-RnPEX14 WT (plasmid) | This paper | Wild-type His-Pex14 | |
| Recombinant DNA reagent | pcDNAZeo-D/His-RnPEX14 SA or SD variants (plasmid) | This paper | His-Pex14 S232A, S232D, S247/252A, S247/252D, S232/247/252A, S232/247/252D | |
| Recombinant DNA reagent | pGEX/RnPEX14 WT (plasmid) | Itoh and Fujiki, 2006 | GST-Pex14 WT | |
| Recombinant DNA reagent | pGEX/His-RnPEX14 SA or SD variants (plasmid) | This paper | GST-Pex14 S232A, S232D, S247/252A, S247/252D, S232/247/252A, S232/247/252D | |
| Recombinant DNA reagent | pGEX/HA-HsCatalase (plasmid) | This paper | for recombinant GST-HA-Catalase | |
| Recombinant DNA reagent | pGEX/ClPEX5S (plasmid) | Otera et al., 2002 | ||
| Recombinant DNA reagent | pGEX/ClPEX5L (plasmid) | Otera et al., 2002 | ||
| Recombinant DNA reagent | pGEX/EGFP-PTS1 (plasmid) | Okumoto et al., 2011 | ||
| Recombinant DNA reagent | pGEX6P-1 (plasmid) | GE Healthcare | 28954648 | |
| Sequence-based reagent | Truncated CMV.Fw | This paper | PCR primer | ATGGGCGGTAGGCGTGTACG |
| Sequence-based reagent | Truncated CMV.Rv: | This paper | PCR primer | CGCGAAGCAGCGCAAAACG |
| Sequence-based reagent | RnPEX14-S232A.InvFw: | This paper | PCR primer | GCCCCGTCAGCCCCGAAGATCCCCTCCT- |
| Sequence-based reagent | RnPEX14-S232D.InvFw: | This paper | PCR primer | GACCCGTCAGCCCCGAAGATCCCCTCCT |
| Sequence-based reagent | RnPEX14-S232A/D.InvRv: | This paper | PCR primer | GGGAGGGAACTGTCTCCGATTC |
| Sequence-based reagent | RnPEX14-S252A.InvFw: | This paper | PCR primer | GCCCCCGCGGCCGTGAACCACCACAGC |
| Sequence-based reagent | RnPEX14-S252D.InvFw: | This paper | PCR primer | GACCCCGCGGCCGTGAACCACCACAGC |
| Sequence-based reagent | RnPEX14-S247_252A.InvRv: | This paper | PCR primer | GGAGGGTGACGGAGCCTTCACTGGG |
| Sequence-based reagent | RnPEX14-S247_252D.InvRv: | This paper | PCR primer | GGAGGGTGACGGGTCCTTCACTGGG |
| Sequence-based reagent | GST-HA-HsCatalase.BglFw: | This paper | PCR primer | GCGCAGATCTATGGCTTATCCATACGAC |
| Sequence-based reagent | pUcD3.Rv: | Otera and Fujiki, 2012 | PCR primer | TTTCCACACCTGGTTGC |
| Chemical compound, drug | U0126 | Cell signaling | 9903S | |
| Chemical compound, drug | SB203580 | Cell signaling | 5633S | |
| Chemical compound, drug | KU-55933 | Abcam | ab120637 | |
| Chemical compound, drug | Compound C | Merck | 171260 | |
| Chemical compound, drug | Complete protease inhibitor cocktail | Roche | 11836170001 | |
| Chemical compound, drug | PhosStop phosphatase inhibitor cocktail | Sigma | 4906845001 | |
| Commercial assay or kit | CellTiter 96 AQueous One Solution Cell Proliferation Assay | Promega | G3580 | |
| Software, algorithm | R | R-project | http://www.r-project.org | |
| Software, algorithm | Image J | NIH | https://imagej.nih.gov/ij/ |