Abstract
Background
Equine endometrosis is a chronic degenerative condition, described as endometrial fibrosis that forms in the stroma, under the basement membrane and around the endometrial glands. The role of lysophosphatidic acid (LPA) in the development of tissue fibrosis varies depending on the organ, and its profibrotic role in mare endometrosis remains unclear. The study aimed to establish the endometrial presence of LPA and its receptors (LPAR1–4), together with its effects on connective tissue growth factor (CTGF) and prostaglandins (PG) secretion from equine endometrium under physiological (estrous cycle), or pathological conditions (endometrosis). Mare endometria in the mid-luteal phase (n = 5 for each category I, IIA, IIB, III of Kenney and Doig) and in the follicular phase (n = 5 for each category I, IIA, III and n = 4 for IIB) were used. In experiment 1, the levels of LPA, LPAR1–4 mRNA level and protein abundance were investigated in endometria at different stages of endometrosis. In experiment 2, the in vitro effect of LPA (10− 9 M) on the secretion of CTGF and PGs from endometrial tissue explants at different stages of endometrosis were determined.
Results
Endometrial LPA concentration was higher in the mid-luteal phase compared to the follicular phase in category I endometrium (P < 0.01). There was an alteration in endometrial concentrations of LPA and LPAR1–4 protein abundance in the follicular phase at different stages of endometrosis (P < 0.05). Additionally, LPA increased the secretion of PGE2 from category I endometrium in both phases of the estrous cycle (P < 0.05). The effect of LPA on the secretion of CTGF and PGF2α from endometrial tissue was altered depending on different stages of endometrosis (P < 0.05).
Conclusion
Our data indicate that endometrosis disturbs proper endometrial function and is associated with altered endometrial LPA concentration, its receptor expression and protein abundance, PGE2/PGF2α ratio, and CTGF secretion in response to LPA. These changes could influence several physiological events occurring in endometrium in mare during estrous cycle and early pregnancy.
Keywords: LPA, CTGF, Prostaglandin, Mare, Endometrosis
Background
Lysophosphatidic acid (LPA) is a small phospholipid present in many mammalian cells and tissues [1]. Lysophosphatidic acid affects cell migration, survival, proliferation, changes in the cytoskeleton and also cellular interactions, which are crucial for many physiological processes [2]. The biological activity of LPA is mediated by activation of its six receptors, LPAR1 to LPAR6, which mediate diverse biological actions. The broad expression of LPARs in tissues and their coupling to a number of types of G proteins (Gq, Gi, Gs, G12/13) underlies their wide variety of cellular and biological activities [1, 3]. Lysophosphatidic acid receptors 1 to 3 are structurally related and included to the endothelial differentiation gene family (EDG). Lysophosphatidic acid receptor 1 is extensively expressed, with strong expression in the brain, colon, heart, placenta, small intestine and prostate [4]. Lysophosphatidic acid receptors 2 and 3 display a more restricted pattern of expression and are expressed in the testis, kidney, heart, lung and brain [5, 6]. High levels of LPAR4 mRNA are expressed in the mammalian ovary [7]. Physiologically, LPA and its active LPARs were found in female reproductive organs, such as the uterus [8–11], ovary [12, 13], oviduct [14] and placenta [15] in human, mouse, pig, sheep and cow. Studies have indicated significant importance of receptor-mediated LPA signaling in mammalian reproduction [8–12]. In cattle, pigs and sheep, LPA is a meaningful mediatorin the control of uterine functions during the estrous cycle and early pregnancy in particular implantation via its effect on endometrial prostaglandin (PG) secretion [9, 16, 17]. Prostaglandins play important role in the proliferation of cells, angiogenesis in the endometrium, implantation of embryos and regulation of the lifespan of the corpus luteum (CL) [18–21].
Besides the above-mentioned role of LPA under physiological condition, LPA was shown to be an important player in the development of tissue fibrosis [22–24]. The importance of LPA in the development of fibrosis varies depending on the organ but its profibrotic effect remains unclear and requires better understanding [22–24]. In vitro studies have shown that in the lungs and peritoneum, LPA may contribute to fibrosis by its effect on connective tissue growth factor (CTGF) secretion and promoting fibroblast proliferation [25, 26]. The high abundance of CTGF was confirmed in the uterine flushing proteome of mares with fibrotic endometrial degeneration and with endometritis [27]. Additionally, LPA induces mesangial cell proliferation, their contractility and PGE2 synthesis [28, 29]. To the best of our knowledge, the endometrial concentration of LPA and its receptor expression, as well as the effects of LPA on CTGF and PG at different stages of equine endometrosis has not yet been described. Equine endometrosis is a chronic degenerative condition, described as fibrosis that forms in the endometrial stroma, under the basement membrane and around the endometrial glands, frequently connected with pathological alteration of glands within fibrotic foci [30–32]. Endometrosis affects secretory function of endometrial cells, causing alteration in the uterine microenvironment and dysfunction in processes occurring in early pregnancy [32–35]. Endometrosis is one of the main reasons for subfertility/infertility in mares and causes a significant economic loss to the horse-breeding industry. In our study, we hypothesized that (1) LPA can affect PG and CTGF secretion from mare endometrium during the estrous cycle; and (2) endometrial level of LPA changes at different stages of endometrosis and enhances CTGF and PGF2α secretion from endometrial tissue. Thus, the study was aimed to establish the endometrial presence of LPA and its receptors (LPAR1–4), together with its effects on PGs and CTGF secretion from equine endometrium under physiological (estrous cycle), or pathological conditions (endometrosis).
Results
Experiment 1. Endometrial LPA concentration, LPAR1–4 mRNA levels and protein abundance at different stages of mare endometrosis
LPA
In categories I, IIA, IIB and III endometria, LPA levels were lower in the follicular phase compared to the mid-luteal phase of the estrous cycle (P < 0.01; Fig. 1). In the follicular phase, the level of LPA was lower in categories IIA, IIB and III endometria compared to category I endometrium (P < 0.01, P < 0.01, P < 0.05, respectively; Fig. 1).
Fig. 1.
Endometrial LPA level during the mid-luteal and follicular phase at different stages of endometrosis (Kenney and Doig’s endometrium categories I, IIA and IIB and III) in equine endometrium. Superscript letters indicate statistical differences between the mid-luteal and follicular phase in Kenney and Doig’s category I a,b category IIA d,e category IIB n,o and category III x,y. Asterisks indicate statistical differences between LPA levels in endometrosis, within the mid-luteal or follicular phase (*P < 0.05; **P < 0.01)
LPAR1
In category III endometrium, LPAR1 mRNA level was higher in the mid-luteal phase compared to the follicular phase (P < 0.05; Fig. 2a). The LPAR1 protein abundance was lower in category IIA endometrium compared to category I and IIB endometria in the follicular phase (P < 0.05; Fig. 2c).
Fig. 2.
LPAR1, LPAR2, LPAR3, LPAR4 mRNA level (a, b, e, f) and protein abundance (c, d, g, h) during the mid-luteal and follicular phase at different stages of endometrosis (Kenney and Doig’s endometrium categories I, IIA and IIB and III) in equine endometrium. Superscript letters indicate statistical differences between the mid-luteal and follicular phase in Kenney and Doig’s category I a,b category IIA d,e category IIB n,o and category III x, y. Asterisks indicate statistical differences between LPAR1, LPAR2, LPAR3, LPAR4 mRNA level/protein abundance in endometrosis, within the mid-luteal or follicular phase (*P < 0.05; **P < 0.01)
LPAR2
In category IIA and IIB endometria, LPAR2 mRNA level was higher in the mid-luteal phase compared to the follicular phase (P < 0.05; P < 0.05; Fig. 2b). In category III endometrium, LPAR2 mRNA level was lower in the mid-luteal phase compared to the follicular phase (P < 0.01; Fig. 2b). Additionally, in the mid-luteal phase, LPAR2 mRNA level decreased in category III, with respect to category IIA endometrium (P < 0.01; Fig. 2b). In the follicular phase, LPAR2 mRNA level was lower in category IIB in comparison to category III endometrium (P < 0.05; Fig. 2b).
In category IIA and III endometria, LPAR2 protein abundance was higher in the mid-luteal phase compared to the follicular phase (P < 0.05; P < 0.05; Fig. 2d). In the follicular phase, LPAR2 protein abundance was lower in category IIA and III endometria compared to category I (P < 0.05; P < 0.05; Fig. 2d). Additionally, in the follicular phase, LPAR2 protein abundance was lower in category III compared to category IIB (P < 0.05; Fig. 2d).
LPAR3
In category I endometrium, LPAR3 mRNA level was lower in the mid-luteal phase compared to the follicular phase (P < 0.05; Fig. 2e). In the follicular phase, LPAR3 mRNA level was higher in category I compared to category III endometrium (P < 0.05; Fig. 2e). The LPAR3 protein abundance was lower in category IIA endometrium compared to categories I, IIB and III endometria in the follicular phase (P < 0.05; Fig. 2g).
LPAR4
In the follicular phase, LPAR4 protein abundance was lower in category IIA endometrium compared to category III endometrium (P < 0.05; Fig. 2h).
Experiment 2. The effect of LPA on CTGF and PG secretion at different stages of mare endometrosis
The basal secretion of PGE2, PGF2α and CTGF in mid-luteal and follicular phase of the estrous cycle at different stages of endometrosis was shown in Table 1. The basal secretion of PGE2 was higher in categories IIA (Table 1; P < 0.05), IIB (Table 1; P < 0.05) and III (Table 1; P < 0.0001) than in category I in the mid-luteal phase, or in category III compared to category I endometrium in the follicular phase of the estrous cycle (Table 1; P < 0.01). The basal secretion of PGF2α increased in category IIB compared to category I in the mid-luteal phase of the estrous cycle (Table 1; P < 0.01), and in category III endometrium with respect to category I endometrium in the follicular phase of the estrous cycle (Table 1.; P < 0.05).
Table 1.
Basal secretion (mean ± standard deviation) of prostaglandin (PG)E2, PGF2α and connective tissue growth factor (CTGF) from equine endometrium in mid-luteal phase and follicular phase of the estrous cycle at different stages of endometrosis. Superscript letters indicate significant differences between different stages of endometrosis within each phase of estrous cycle
mid-luteal phase of estrous cycle | ||||
---|---|---|---|---|
Category according to Kenney and Doig | I | II A | II B | III |
PGE2 (ng/g tissue) | 408.54 ± 42.04a | 1116 ± 405.1b | 1201 ± 111.5b | 2090 ± 211.4c |
PGF2α (ng/g tissue) | 1590 ± 222.1a | 1895 ± 311.4a | 2907 ± 567.4b | 1865 ± 401.1a |
CTGF (ng/g tissue) | 8.148 ± 3.27a | 6.563 ± 0.864a | 6.076 ± 4.007a | 6.123 ± 1.511a |
follicular phase of estrous cycle | ||||
PGE2 (ng/g tissue) | 1460 ± 494.9a | 2374 ± 385.3ab | 1657 ± 365.1a | 4296 ± 2307b |
PGF2α (ng/g tissue) | 1310 ± 225.2a | 1586 ± 285.6ab | 2245 ± 636.8ab | 3237 ± 1793b |
CTGF (ng/g tissue) | 5.717 ± 3.534a | 4.510 ± 1.300a | 7.399 ± 3.692a | 4.710 ± 1.001a |
Lysophosphatidic acid stimulated PGE2 secretion from endometrial tissue in all equine endometrial categories, in comparison to the respective control group in the mid-luteal phase (Fig. 3a; P < 0.05; category I – 152.1%; II A – 144.8%; II B- 155.6%; II – 150.3% of respective control). Additionally, LPA stimulated PGE2 secretion from endometrial tissue in category I compared to the respective control group in the follicular phase (Fig. 3a; P < 0.05; 136.6% of respective control).
Fig. 3.
Effect of LPA (10− 9 M) on (a) PGE2, (b) PGF2α, (c) CTGF secretion by endometrial explants from mid-luteal and follicular phase of the estrous cycle at different stages of endometrosis. The endometrial explants were assigned to categories I, IIA, IIB and III according to Kenney and Doig. All values are expressed as % of control. The effect of LPA on PG and CTGF secretion in comparison to control group within each category was analyzed by nonparametric Mann-Whitney U test. Asterisks indicate statistical differences within each of Kenney and Doig category (*P < 0.05)
Lysophosphatidic acid increased PGF2α secretion from endometrial tissue in category III in the mid-luteal phase (Fig. 3b; P < 0.05; 172.89% of respective control) and from category IIB in the follicular phase (Fig. 3b; P < 0.05; 279.1% of respective control) compared to the respective control groups. Lysophosphatidic acid increased CTGF secretion from endometrial tissue in category IIB and III in the mid-luteal phase (Fig. 3c; P < 0.05; category II B – 180.7%; category III − 177.6% of respective control) and in category I in the follicular phase, compared to the respective control groups (Fig. 3c; P < 0.05; 155.5%).
Lysophosphatidic acid up-regulated prostaglandin-endoperoxide synthase 2 (PTGS2) mRNA level in endometrial tissue in category I (1.5-fold change) in mid-luteal phase (Fig. 4a; P < 0.05) and in categories I (1.6-fold change), IIA (2.3- fold change), IIB (1.8-fold change) and III (1.6-fold change) in the follicular phase (Fig. 4a; P < 0.05) compared to the respective control group. Additionally, LPA up-regulated prostaglandin E2 synthase (PGES) mRNA level in endometrial tissue in categories I (3.14-fold change), IIA (1.5-fold change), IIB (1.7-fold change) and III (2.4-fold change) in the mid-luteal phase, and also in category III (1.7-fold change) endometrium in the follicular phase relative to the respective control group (Fig. 4b; P < 0.05).
Fig. 4.
Effect of LPA (10− 9 M) on a) PTGS2, b) PGES, c) PGFS mRNA level in endometrial tissue in the mid-luteal and follicular phase of the estrous cycle at different stages of endometrosis. The endometria were assigned to categories I, IIA, IIB and III according to Kenney and Doig. All values are expressed as a fold change. The effect of LPA on PG synthases mRNA level in comparison to control group within each category was analyzed by nonparametric Mann-Whitney U test. Asterisks indicate statistical differences between the groups (*P < 0.05)
Lysophosphatidic acid up-regulated prostaglandin F2α synthase (PGFS) mRNA level in endometrial tissue in category III (3.31-fold change), in comparison to their respective control groups in the mid-luteal phase (Fig. 4c; P < 0.05). Additionally, LPA up-regulated PGFS mRNA level in endometrial tissue in categories IIA (2.4-fold change) and IIB (2.6-fold change) in the follicular phase compared to the respective control groups (Fig. 4c; P < 0.05).
Discussion
The role of LPA in mare reproduction remains unclear. To the best of our knowledge, our study is the first one to examine the level of LPA, LPAR1–4 mRNA level and protein abundance as well as their action in endometrium in the mid-luteal and follicular phase of the estrous cycle in mare. In the present study, we showed that endometrial concentration of LPA is higher in the mid-luteal phase compared to the follicular phase, indicating its potential role during this period of estrous cycle. We also demonstrated that in category I endometrium LPA increased PGE2 secretion in both follicular and mid-luteal phases, and CTGF only in the follicular phase of the estrous cycle.
The cyclic changes and proper functioning of endometrium depend on the concentration of hormones and their balance. A change in the expression of any of the players might impact on the expression of other factors, which might threaten endometrial homeostasis and many physiological processes. The data obtained in this study indicate that the PGE2/PGF2α ratio and CTGF secretion in response to LPA are disturbed at different stages of endometrosis, which may affect the microenvironment of mare endometrium. Additionally, the protein abundance of LPR1–4 is reduced mainly in category IIA endometria in the follicular phase of the estrous cycle. Generally, LPA plays a key role in embryonic development, implantation, and pregnancy establishment in many species [8, 17, 36]. In porcine endometrium, LPA up-regulated PTGS2 expression, which suggests an important role in endometrial function and conceptus development in this species [9]. In turn, in bovine endometrium, LPA stimulated PGE2 synthesis and inhibited in vitro PGF2α synthesis on days 16–18 of the estrous cycle and pregnancy [36]. Additionally, LPA has been shown to be an important regulator of cell proliferation [37], angiogenesis [38], inflammation [39], tissue repair and remodeling [40, 41] in different tissues suggesting its involvement in these processes in mare endometrium. Moreover, this phospholipid programs fibroblasts to produce a plethora of paracrine mediators of tissue remodeling, angiogenesis, inflammation, such as chemokines, growth factors, cytokines, pro-angiogenic and pro-fibrotic factors, components of the plasminogen activator system and metallopeptidases (MMP) [41]. These processes and paracrine mediators are essential modulators of endometrium function during the estrous cycle, as well as in early pregnancy. Thus, the alteration of LPA concentration and action at the different stages of endometrosis may disturb these physiological processes.
In the present study, we have shown that CTGF is secreted in response to LPA in the follicular phase in category I endometrium, in contrast to other stages of endometrosis. The physiological role of CTGF in mare endometrium in not yet understood. The pattern of CTGF expression by porcine endometrial cells suggests the involvement of this factor in stroma remodeling and angiogenesis [42]. In the mare, CTGF seems to play an important role in the non-pregnant uterus, while its expression is decreased during early pregnancy [43–45]. Since in mare healthy endometrium LPA stimulated CTGF production, it might be suggested that this cytokine is an important regulator of endometrial cell proliferation, remodeling and angiogenesis, as described for other species [42–45]. In addition, our findings suggest that these processes can be disturbed by changes in CTGF secretion in response to LPA at different stages of endometrosis.
The profibrotic effect of LPA and the augmented expression of LPA and LPARs have been demonstrated in the arterial, lung and liver fibrosis in studies in human and animal models [22, 23, 46–48]. But, our study showed that while in the mid-luteal phase the endometrial level of LPA was not changed at different stages of endometrosis, in the follicular phase, the level of LPA was lower at different stages of endometrosis, in comparison to category I endometrium. Although the level of LPA did not increase at different stages of fibrosis, it is possible that LPA indirectly stimulates fibrogenesis by acting on PGF2α and CTGF. The present study showed that LPA increased CTGF in vitro secretion from category IIB and III endometria in the mid-luteal phase. It also raised PGF2α secretion from category III endometrium in the mid-luteal phase and category IIB endometrium in the follicular phase of the estrous cycle. These players were reported as important factors in the development of fibrosis [49–58]. Prostaglandin F2α has been demonstrated as an inductor of fibrogenesis in several pathogenic conditions, such as pulmonary and myocardial fibrosis and is often linked to disease severity and prognosis [49–51]. In the mare, PGF2α has been shown to increase the expression of collagen 1 and MMPs in endometrial fibroblast [52]. Likewise, CTGF supports glomerular and renal interstitial fibrosis in different kidney diseases [53]. Other studies showed that LPA might contribute to fibrosis by stimulation of CTGF, driving fibroblast proliferation in a paracrine manner [26]. This cytokine affects cell proliferation, migration, and differentiation and promotes the progression of fibrosis, either directly [54], or indirectly, by acting as a downstream regulator of TGF-β1 [55, 56]. Additionally, CTGF up-regulated fibrosis markers (TGF-β1 and tissue matrix metalloproteinase inhibitor-1), collagen (COL)1 and COL3 mRNA levels, and decreased PGE2 production from mare endometrial explants [57, 58].
In our experimental design, we examined endometrial samples from mares with different degree of fibrosis. Since endometria were obtained post-mortem, it was not feasible to evaluate the evolution of the fibrogenic process in individual mares. The current design may have affected the results, and thus it could explain the inconsistent pattern of our observed changes. Possibly, our inconsistent results could be also ascribed to cellular adaptation to achieve a new steady state compatible with cell viability in the new environment. Therefore, further studies should be carried out to elucidate our findings.
Conclusion
In category I endometrium, LPA concentration increased in the mid-luteal phase compared to the follicular phase of the estrous cycle and LPA increased CTGF and PGE2 secretion. Additionally, concentrations of endometrial LPA and LPAR1–4 mRNA level and protein abundance in the follicular phase were altered at different stages of endometrosis. The effect of LPA on the secretion of CTGF and PG from endometrial tissue was changed at different stages of endometrosis. Our data indicate that endometrial degeneration disturbs proper endometrial function and thus changed endometrial LPA concentration, its receptor expression and protein abundance, PGE2/PGF2α ratio and CTGF secretion in response to LPA treatment. These changes could influence several physiological events occurring in endometrium in mare during estrous cycle and early pregnancy such as cell proliferation, angiogenesis, inflammation, tissue repair and tissue remodeling.
Methods
Endometrial material
The endometrial tissues (n = 39; Table 2) were retrieved post-mortem from the uterus of cyclic mares (Polish cold-blood horse) at different ages (2–15) weighing around 500–700 kg, at a commercial abattoir euthanized according to European Legislation (EFSA, AHAW/04–027) with protection of animal welfare in order to eliminate pain and suffering of animals. All procedures for the collection of material were accepted by the Local Ethics Committee for Experiments on Animals in Olsztyn, Poland (Agreements No. 51/2011). To ensure that a sufficient number of animals would be available for each experimental group around 160 endometrial samples were obtained over reproductive season (April to July). The mares were healthy according to official government veterinary inspection. The mares were raised in a farm as food animals and slaughtered in order to obtain meat. The endometrial samples were obtained average within 5 min of the animals’ slaughter. Just before slaughter, peripheral blood were taken into heparinized tubes for subsequent progesterone (P4) analysis. In the present study, the following phases of the estrous cycle were considered: mid-luteal phase (n = 5 for each category I, IIA, IIB, III) and follicular phase (n = 5 for each category I, IIA, III and n = 4 for category IIB). The same endometria were used in Experiment 1, as well as in Experiment 2. The determination of phase of estrous cycle based on analysis of P4 as well as macroscopic observation of the ovaries [59]. At the mid-luteal phase, we confirmed the presence of a well-developed corpus luteum (CL) associated with follicles 15–20 mm in diameter and P4 > 6 ng/mL. The mare ovary in follicular phase we confirmed the absence of an active CL and the presence of a follicle > 35 mm in diameter, with a P4 concentration < 1 ng/mL [59].
Table 2.
Experimental procedures used for determination of endometrial LPA, LPAR1–4 mRNA level and protein abundance, effect of LPA on PG and CTGF secretion at different stages of endometrosis. Ctr-control, LPA-lysophosphatidic acid, AA- arachidonic acid
Experiment 1 | ||||||||||||||||||||||||
phase of estrous cycle | MID-LUTEAL | FOLLICULAR | ||||||||||||||||||||||
category | I | II A | II B | III | I | II A | II B | III | ||||||||||||||||
sample (n) | n = 5 | n = 5 | n = 5 | n = 5 | n = 5 | n = 5 | n = 4 | n = 5 | ||||||||||||||||
Experiment 2 | ||||||||||||||||||||||||
phase of estrous cycle | MID-LUTEAL | FOLLICULAR | ||||||||||||||||||||||
category | I | II A | II B | III | I | II A | II B | III | ||||||||||||||||
treatment | c | LPA | AA | c | LPA | AA | c | LPA | AA | c | LPA | AA | c | LPA | AA | c | LPA | AA | c | LPA | AA | c | LPA | AA |
sample (n) | 5 | 5 | 5 | 5 | 5 | 5 | 5 | 5 | 5 | 5 | 5 | 5 | 5 | 5 | 5 | 5 | 5 | 5 | 4 | 4 | 4 | 5 | 5 | 5 |
Endometrium was resected from the uterine horns, ipsilateral to the CL (mid-luteal phase) or to the growing follicle (follicular phase), washed with cold sterile RNAse-free saline solution, placed into: (i) 4% buffered paraformaldehyde for hematoxylin-eosin staining [59]; (ii) RNAlater (#AM7021; Invitrogen) for LPAR mRNA level determination using qPCR; or (iii) liquid nitrogen for LPA concentration measurement and LPAR protein abundance using Western-blot.
For tissue culture, endometrial explants were put into sterile, incomplete (Ca2+- and Mg2+-free) Hanks’ balanced salt solution (HBSS; H1387; Sigma-Aldrich) containing gentamicin (20 μg/mL; G1272; Sigma-Aldrich) and 0.1% bovine serum albumin (BSA; A9418; Sigma-Aldrich), kept on ice and transported quickly to the laboratory. Additionally, before running any of the experiments, all endometria were confirmed to be free from bacterial endometritis, by microscopic evaluation of endometrial smears collected with sterile swabs before the endometrium pieces were excised from the myometrium and stained with Diff-Quick [60]. The presence of bacteria detected by cytological examination was the criterion for tissue rejection prior to experiments. As previously defined, the presence of more than two neutrophils per four microscopic fields (mag = 400X) indicate an acute endometritis [61].
The in vitro treatment of endometrial explants with LPA was performed before the histopathological categorization of the endometrium according to Kenney and Doig [31]. Endometrosis was graded according to Kenney and Doig’s classification [31], based on the intensity of fibrosis as well as endometrial gland characteristics (glandular nests, glandular hypertrophy, glandular atrophy and glandular cysts), as category I, IIA, IIB or III, corresponding to minimum, mild, moderate or severe lesions of endometrosis, respectively.
Therefore, sufficient number of repetitions of each experiment were carried out using the collected samples (Table 2). All the explants were collected after treatments and were stored at -80 °C until Kenney and Doig category were assessed and the sufficient number of samples were assigned to each group before further analysis. During the experimental work regarding ELISA, radioimmunoassay (RIA) and qPCR, the researchers were blinded to mare endometrial categories of the samples.
Experimental procedures
Experiment 1. Endometrial LPA concentration, LPAR1–4 mRNA levels and protein abundance at different stages of mare endometrosis
Mares from the mid-luteal phase (n = 5 for each category I, IIA, IIB, III) and from the follicular phase (n = 5 for each category I, IIA, III and n = 4 for category IIB) were used. The determination of endometrial LPA level was performed using ELISA. The concentration of LPA was assessed per 1 mg of tissue. The LPAR1–4 mRNA levels and protein abundance analyses were performed using qPCR and Western-blot, respectively.
Experiment 2. The effect of LPA on CTGF and PG secretion at different stages of mare endometrosis
Uteri from mid-luteal phase (n = 5 for each category I, IIA, IIB, III) and follicular phase (n = 5 for each category I, IIA, III and n = 4 for each category IIB) were used. The endometrial tissue was cut into small pieces (~ 50 mg), then rinsed three times in PBS containing gentamicin (20 μg/mL), and placed into culture tubes with 1 mL Dulbecco’s Modified Eagle’s medium without phenol red (Sigma–Aldrich; 2960) supplemented with 0.1% BSA and antibiotic/antimycotic solution. Tissue pieces were preincubated on a shaker inside a tissue culture incubator at 38.0 °C with 5% CO2 in air for 1 h. Afterwards, the medium was replaced with fresh DMEM supplemented with 0.1% BSA and antibiotics/antimycotic for further incubation with vehicle (negative control), LPA agonist (1-oleoyl-sn-glycerol 3-phosphate sodium salt; 10− 9 M; 857130P; Avanti Polar Lipids) or arachidonic acid (AA; 50 ng/ml; Sigma-Aldrich; SML1395) for 24 h. Each treatment was carried out in triplicate for all samples from each mare. The dose of LPA was chosen in a preliminary study. The responsiveness of tissues was tested by their incubation for 24 h with AA (50 ng/mL) as a positive control. Measurement of PGE2 was performed (supplementary data 1). The conditioned culture medium was collected in tubes with 5% ethylenediaminetetraacetic acid (EDTA) and 1% acetylsalicylic acid solution (pH = 3). Samples were kept frozen at − 20 °C until CTGF and PG concentrations were determination using ELISA. The endometrial explants were placed in RNAlater® (Sigma-Aldrich; R0901), and stored at − 80 °C until determination of PTGS2, PGES and PGFS mRNA levels using qPCR. In order to normalize the results, PG and CTGF concentration was determined per 1 g of tissue.
Viability of endometrial tissues was assessed using AlamarBlue™ (Invitrogen; #DAL1025) in accordance with the manufacturer’s instructions. After a 24 h of incubation of endometrium, its viability was determined and compared to pre-treatment viability within the control and treatment groups.
Analytic methods
LPA extraction
The extraction of LPA from the equine endometrium was performed using a method described previously [62]. Briefly, 1-oleoyl-LPA contained in 100 mg of tissue was extracted with one volume of 1-butanol. After agitation and centrifugation (5 min. at 3000 g), the upper 1-butanol phase was collected and then evaporated under nitrogen at 50 °C.
Total RNA extraction and cDNA synthesis
Total RNA was extracted using TRI Reagent® (T9424; Sigma-Aldrich) following the manufacturer’s information. Concentration and quality of RNA were determined spectrophotometrically and by agarose gel electrophoresis. The ratio of absorbance at 260 and 280 nm (A260/280) was approximately 2. One microgram of total RNA was reverse transcribed into cDNA using a QuantiTect Rev. Transcription Kit (205,313; Qiagen) following the manufacturer’s instructions. The cDNA was stored at − 20 °C until qPCR was carried out.
qPCR
qPCR was conducted according to Szóstek-Mioduchowska et al. [63]. The primers for LPAR1–4 were designed using Primer-BLAST and were synthesized by Sigma-Aldrich. All samples were run in duplicates. Table 3 includes primer sequences, length of expected qPCR product and GenBank accession numbers of LPAR1, LPAR2, LPAR3, LPAR4 and succinate dehydrogenase complex flavoprotein subunit A (SDHA; reference gene, chosen as reported previously [34]). Primers for PTGS2, PGES and PGFS were reported previously [34]. qPCR was performed in 384-well plates with an ABI Prism 7900 sequence detection system using SYBR Green PCR master mix (Applied Biosystems, Foster City, CA). The volume of total reaction was 10 μL: 3 μL of cDNA (1 ng), 1 μL of each forward and reverse primers (500 nM) and 5 μL of SYBR Green PCR master mix. Conditions of qPCR reactions were as follows: initial denaturation (2 min at 50 °C; 10 min at 95 °C), followed by 42 cycles of denaturation (15 s at 95 °C) and annealing (1 min at 60 °C). After each qPCR reaction, melting curves were obtained by stepwise increases in temperature from 60 °C to 95 °C to ensure single-product amplification. Nuclease-free water (129,114; Qiagen), instead of cDNA, was used as a negative control. The specificity of the product was also confirmed by electrophoresis on 2% agarose gel.
Table 3.
Primers used for qPCR for determination of endometrial LPAR1–4 mRNA level at different stages of endometrosis
Gene name | Primer sequence (5′ – 3′) | Amplicon length (bp) | Accession no. GenBank |
---|---|---|---|
SDHA | GAGGAATGGTCTGGAATACTG | 91 | DQ402987.1 |
GCCTCTGCTCCATAAATCG | |||
LPAR1 | TTCAACTCTGCCATGAACC | 85 | XM_014735958 |
GCTGGCAGCAGAGGATCT | |||
LPAR2 | CTCAGCCGCTCCTACCTG | 71 | XM_023625558 |
TAGACAGCCACCATGAGCAG | |||
LPAR3 | TCGCAGCAGTGATCAAAAAC | 122 | XM_001917815 |
TGGGCCAGTGTTAAACATCA | |||
LPAR4 | GGCAATGCTACTGCCAATAA | 104 | XM_001501421 |
TTGGTTATCAGACCCAGGATG |
Data were analyzed using the method described by Zhao and Fernald [64]. The relative concentration of mRNA (R0) for each target and reference gene (SDHA) was calculated using the eq. R0 = 1/(1 + E)Ct, where, E is the average gene efficiency and Ct is the cycle number at threshold. The relative gene expression was calculated as R0target gene/R0reference gene and was expressed in arbitrary units.
Western-blot
Western-blot was done as described recently [57]. All samples were run in duplicate. The membranes were collected after electrophoresis and then incubated overnight at 4 °C with LPA1 Polyclonal antibody (Cayman; 10,005,280; 1:100), EDG-4 antibody (H-55) (Santa Cruz; sc-25,490; 1:100), LPA3 Polyclonal Antibody (Cayman; 10,004,840; 1:100), P2Y9 Antibody (N-20) (Santa Cruz sc-46,021 1:700) and anti-GAPDH antibody [6C5] (Abcam; ab8245; 1:1000). The LPAR1, LPAR2 and LPAR3 proteins were detected by incubating the membranes with secondary monoclonal anti-rabbit alkaline phosphatase-conjugated antibody (Bethyl; A120-212P; 1:20,000) for 1.5 h at room temperature. The protein LPAR4 and GAPDH protein were detected with Goat IgG-heavy and light chain Antibody (Bethyl; A50-100P; 1:50,000) and mouse IgG-heavy and light chain Antibody (Bethyl; A90-116P; 1:5000), respectively, for 1.5 h at room temperature. The immune complexes were visualized using chemiluminescence (SuperSignal™ West Dura Extended Duration Substrate; 34,076; Thermo Scientific). Antibody dilution buffers, instead of the primary antibody solution, were used as a negative control. The secondary antibodies were incubated with the samples according to the above described protocol. This allowed to eliminate non-specific binding or false positives signals due to non-specific binding of the secondary antibody. The blots were scanned, and the specific bands were quantified using the VersaDoc MP 4000 System for densitometric analyses. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used as an internal control for protein loading. The original, full-length blots are included in Supplementary data 2.
ELISA assay
The concentration of LPA in endometrial tissue was determined using the Lysophosphatidic Acid Assay Kit II (Echelon Biosciences Inc.; #K-2800S) following the manufacturer’s instructions. All samples were run in duplicate. The standard curve for LPA ranged from 0.064 μM to 200 μM. The intra- and inter-assay coefficients of variation (CVs) were 7.3 and 9.2%, respectively.
The concentration of PGE2 in the conditioned medium was determined using the Prostaglandin E2 EIA kit (Cayman Chemical Company; #514010) following the manufacturer’s instructions. The standard curve for PGE2 ranged from 16.5 pg/mL to 1000 pg/mL. The intra- and inter-assay CVs were 8 and 12%, respectively. The concentration of PGF2α in the conditioned medium was determined using the PGF2α ELISA kit (Enzo Life Sciences; ADI-900-069) following the manufacturer’s instruction. The standard curve for PGF2α ranged from 3 pg/mL to 50,000 pg/mL. The intra- and inter-assay CVs were 9 and 11%, respectively. The concentration of CTGF in the conditioned medium was determined using the Enzyme-linked Immunosorbent Assay Kit for Connective Tissue Growth Factor (Cloud-Clone; SEA010Po) following the manufacturer’s instruction. The standard curve for CTGF ranged from 0.63 ng/mL to 40 ng/mL. The intra- and inter-assay CVs were 8 and 11%, respectively.
Radioimmunoassay
Plasma concentrations of P4 were assayed by RIA (Diasource; KIP1458). All samples were run in duplicate. The P4 standard curve ranged from 0.12 to 36 ng/mL. The intra- and inter-assay CVs were on average 8 and 10%, respectively.
Statistical analysis
For each statistical analysis, a Gaussian distribution was tested using the D’Agostino & Pearson normality test (GraphPad Software version 7; GraphPad, San Diego, CA, USA). The data are shown as mean ± standard deviation (SD). The data were not transformed. Data from Experiment 2 are expressed as fold change. In Experiment 1. a two-way ANOVA followed by Bonferroni multiple comparison test was used. Differences in Kenney and Doig’s category I, II A, IIB and III endometria within mid-luteal and follicular phase of the estrous cycle, and between those groups were assessed. In Experiment 2, the effect of LPA on gene expression and PG and CTGF secretion in comparison to the control group within each category was analyzed by the nonparametric Mann-Whitney U test. The basal secretion of PGE2, PGF2α and CTGF between different stages of endometrosis, within each phase of estrous cycle, was analyzed using one-way ANOVA followed by Tukey’s multiple comparisons test. The results were considered significantly different at P < 0.05.
Supplementary information
Acknowledgements
Authors would like thank Agnieszka Bacławska, Karolina Lukasik and Witold Krzywiec for their technical support.
Abbreviations
- BSA
Bovine serum albumin
- CL
Corpus luteum
- COL
Collagen
- CTGF
Connective tissue growth factor
- GAPDH
Glyceraldehyde-3-phosphate dehydrogenase
- LPA
Lysophosphatidic acid
- PG
Prostaglandin
- PTGS2
Prostaglandin-endoperoxide synthase 2
- PGES
Prostaglandin E2 synthase
- PGFS
Prostaglandin F2α synthase
- SDHA
Succinate dehydrogenase complex flavoprotein subunit A
Authors’ contributions
A.Sz-M – writing-original draft, conception and design of study, methodology, investigation, formal analysis, visualization; N.L – performed histological analysis, B.Z - investigation; J.S-Ch – investigation; G.F-D; D.S – writing-review and editing. All authors edited, revised and approved final version of the manuscript.
Funding
Supported by the National Science Center Grant in Aid MAESTRO No2011/02/A/NZ5/00338 to DJS. NL was financed within the framework of Ministry of Science and Higher Education programme as “Regional Initiative Excellence”2019–2022, Project No. 005/RID/2018/19″. Polish National Science Centre and Ministry of Science and Higher Education were the founders of the research but did not participate in the design of the study and collection, analysis, and interpretation of data, as well as writing the manuscript.
Availability of data and materials
The data that support the findings of this study are available from the corresponding author upon reasonable request.
Ethics approval and consent to participate
All procedures for collection of tissues were accepted by the Local Ethics Committee for Experiments on Animals in Olsztyn, Poland (Agreements No. 51/2011). All contests were given by the abattoir (AF/114/2013 from 26.06.2013) and State Veterinary Inspection (Decision no. PIW.pl.0740.41.2014 from 24.04.2014) to take tissue samples from slaughtered animals.
Consent for publication
Not applicable.
Competing interests
The authors have declared no competing interests.
Footnotes
Publisher’s Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Supplementary information
Supplementary information accompanies this paper at 10.1186/s12917-020-02562-6.
References
- 1.Lin M, Herr DR, Chun J. Lysophosphatidic acid - (LPA) receptors: signaling properties and disease relevance. Prostaglandins Other Lipid Mediat. 2010;91:130–138. doi: 10.1016/j.prostaglandins.2009.02.002. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2.Moolenaar WH, Van Meeteren LA, Giepmans BNG. The ins and outs of lysophosphatidic acid signaling. BioEssays. 2004;26:870–881. doi: 10.1002/bies.20081. [DOI] [PubMed] [Google Scholar]
- 3.Yung YC, Stoddard NC, Chun J. LPA receptor signaling: pharmacology, Physiology and Pathophysiology. J Lipid Res. 2014;55:1192–1214. doi: 10.1194/jlr.R046458. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Hecht JH, Weiner JA, Post SR, Chun J. Ventricular zone gene-1 (vzg-1) encodes a lysophosphatidic acid receptor expressed in neurogenic regions of the developing cerebral cortex. J Cell Biol. 1996;135:1071–1083. doi: 10.1083/jcb.135.4.1071. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5.Contos JJA, Chun J. The mouse lp A3 / Edg7 lysophosphatidic acid receptor gene : genomic structure, chromosomal localization and expression pattern. Gene. 2001;267:243–253. doi: 10.1016/S0378-1119(01)00410-3. [DOI] [PubMed] [Google Scholar]
- 6.Anliker B, Chun J. Cell surface receptors in lysophospholipid signaling. Semin Cell Dev Biol. 2004;15:457–465. doi: 10.1016/j.semcdb.2004.05.005. [DOI] [PubMed] [Google Scholar]
- 7.Noguchi K, Ishii S, Shimizu T. Identification of p2y 9/GPR23 as a novel G protein-coupled receptor for Lysophosphatidic acid, structurally distant from the Edg family. J Biol Chem. 2003;278:25600–25606. doi: 10.1074/jbc.M302648200. [DOI] [PubMed] [Google Scholar]
- 8.Ye X, Hama K, Contos JJA, Anliker B. LPA3-mediated lysophosphatidic acid signalling in embryo implantation and spacing. Nature. 2005;435:104–108. doi: 10.1038/nature03505. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Seo JH, Kim M, Choi Y, Lee CK, Ka H. Analysis of lysophosphatidic acid (LPA) receptor and LPA-induced endometrial prostaglandin-endoperoxide synthase 2 expression in the porcine uterus. Endocrinology. 2008;149:6166–6175. doi: 10.1210/en.2008-0354. [DOI] [PubMed] [Google Scholar]
- 10.Liszewska E, Reinaud P, Dubois O, Charpigny G. Lysophosphatidic acid receptors in ovine uterus during estrous cycle and early pregnancy and their regulation by progesterone. Domest Anim Endocrinol. 2012;42:31–42. doi: 10.1016/j.domaniend.2011.08.003. [DOI] [PubMed] [Google Scholar]
- 11.Boruszewska D, Kowalczyk-Zieba I, Sinderewicz E, Staszkiewicz J, Woclawek-Potocka I. The effect of lysophosphatidic acid together with interferon tau on the global transcriptomic profile in bovine endometrial cells. Theriogenology. 2017;92:111–120. doi: 10.1016/j.theriogenology.2017.01.021. [DOI] [PubMed] [Google Scholar]
- 12.Chen S, Chou C, Lee H, Ho C, Lin C, Yang Y. Lysophosphatidic acid up-regulates expression of interleukin-8 and -6 in granulosa-lutein cells through its receptors and nuclear factor-κB dependent pathways: implications for angiogenesis of corpus luteum and ovarian hyperstimulation syndrome. J Clin Endocrinol Metab. 2008;93:935–943. doi: 10.1210/jc.2007-1512. [DOI] [PubMed] [Google Scholar]
- 13.Sinderewicz E, Grycmacher K, Boruszewska D, Kowalczyk-Zięba I, Staszkiewicz J, Ślężak T, Woclawek-Potocka I. Bovine ovarian follicular growth and development correlate with lysophosphatidic acid expression. Theriogenology. 2018;106:1–18. doi: 10.1016/j.theriogenology.2017.09.027. [DOI] [PubMed] [Google Scholar]
- 14.Sinderewicz E, Grycmacher K, Boruszewska D, Yamamoto Y, Yoshimoto Y. Lysophosphatidic acid synthesis and its receptors ’ expression in the bovine oviduct during the Oestrous cycle. Reprod Domest Anim. 2016;51:541–549. doi: 10.1111/rda.12717. [DOI] [PubMed] [Google Scholar]
- 15.Iwasawa Y, Fujii T, Nagamatsu T, Kawana K, Okudaira S, Miura S. Expression of Autotaxin, an Ectoenzyme that produces Lysophosphatidic acid in human placenta. Am J Reprod Immunol. 2009;62:90–95. doi: 10.1111/j.1600-0897.2009.00715.x. [DOI] [PubMed] [Google Scholar]
- 16.Woclawek-Potocka I, Komiyama J, Saulnier-Blache JS, Brzezicka E, Bah MM, Okuda K, Skarzynski DJ. Lysophosphatic acid modulates prostaglandin secretion in the bovine uterus. Reproduction. 2009;137:95–105. doi: 10.1530/REP-08-0209. [DOI] [PubMed] [Google Scholar]
- 17.Liszewska E, Reinaud P, Billon-Denis E, Dubois O, Robin P, Charpigny G. Lysophosphatidic acid signaling during embryo development in sheep : involvement in prostaglandin synthesis. Endocrinology. 2009;150:422–434. doi: 10.1210/en.2008-0749. [DOI] [PubMed] [Google Scholar]
- 18.McCracken JA, Custer EE, Lamsa JC. Luteolysis: a neuroendocrine-mediated event. Physiol Rev. 1999;79:263–323. doi: 10.1152/physrev.1999.79.2.263. [DOI] [PubMed] [Google Scholar]
- 19.Jabbour HN, Boddy SC. Prostaglandin E2 induces proliferation of glandular epithelial cells of the human endometrium via extracellular regulated kinase 1/2-mediated pathway. J Clin Endocrinol Metab. 2003;88:4481–4487. doi: 10.1210/jc.2003-030297. [DOI] [PubMed] [Google Scholar]
- 20.Milne SA, Jabbour HN. Prostaglandin (PG) F(2alpha) receptor expression and signaling in human endometrium: role of PGF(2alpha) in epithelial cell proliferation. J Clin Endocrinol Metab. 2003;88:1825–1832. doi: 10.1210/jc.2002-021368. [DOI] [PubMed] [Google Scholar]
- 21.Kennedy TG, Gillio-Meina C, Phang SH. Prostaglandins and the initiation of blastocyst implantation and decidualization. Reproduction. 2007;134:635–643. doi: 10.1530/REP-07-0328. [DOI] [PubMed] [Google Scholar]
- 22.Tangkijvanich P, Melton AC, Chitapanarux T, Han J, Yee HF. Platelet-derived growth factor-BB and Lysophosphatidic acid distinctly regulate hepatic Myofibroblast migration through focal adhesion kinase. Exp Cell Res. 2002;281:140–147. doi: 10.1006/excr.2002.5657. [DOI] [PubMed] [Google Scholar]
- 23.Tager AM, LaCamera P, Shea BS, Campanella GS, Selman M, Zhao Z, Polosukhin V, Wain J, Karimi-Shah BA, Kim ND, Hart WK, Pardo A, Blackwell TS, Xu Y, Chun J, Luster AD. The lysophosphatidic acid receptor LPA 1 links pulmonary fibrosis to lung injury by mediating fibroblast recruitment and vascular leak. Nat Med. 2008;14:45–54. doi: 10.1038/nm1685. [DOI] [PubMed] [Google Scholar]
- 24.Ninou I, Magkrioti C, Aidinis V. Autotaxin in pathophysiology and pulmonary fibrosis. Front Med. 2018;5:1–11. doi: 10.3389/fmed.2018.00180. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.Gan L, Xue JX, Li X, Liu DS, Ge Y, Ni PY, Deng L, Lu Y, Jiang W. Blockade of lysophosphatidic acid receptors LPAR1/3 ameliorates lung fibrosis induced by irradiation. Biochem Biophys Res Commun. 2011;409:7–13. doi: 10.1016/j.bbrc.2011.04.084. [DOI] [PubMed] [Google Scholar]
- 26.Sakai N, Chun J, Duffield JS, Wada T, Luster AD, Tager AM. LPA1-induced cytoskeleton reorganization drives fibrosis through CTGF-dependent fibroblast proliferation. FASEB J. 2013;27:1830–1846. doi: 10.1096/fj.12-219378. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27.Diel de Amorim M, Khan FA, Chenier TS, Scholtz EL, Hayes MA. Analysis of the uterine flush fluid proteome of healthy mares and mares with endometritis or fibrotic endometrial degeneration. Reprod Fertil Dev. 2020;32(6):572–581. doi: 10.1071/RD19085. [DOI] [PubMed] [Google Scholar]
- 28.Inoue CN, Forster HG, Epstein M. Effects of lysophosphatidic acid, a novel lipid mediator, on cytosolic Ca2+ and contractility in cultured rat mesangial cells. Circ Res. 1995;77:888–896. doi: 10.1161/01.RES.77.5.888. [DOI] [PubMed] [Google Scholar]
- 29.Gaits F, Salles JP, Chap H. Dual effect of lysophosphatidic acid on proliferation of glomerular mesangial cells. Kidney Int. 1997;51:1022–1027. doi: 10.1038/ki.1997.143. [DOI] [PubMed] [Google Scholar]
- 30.Kenney RM. Cyclic and pathologic changes of the mare endometrium as detected by biopsy, with a note on early embryonic death. J Am Vet Med Assoc. 1978;172:241–262. [PubMed] [Google Scholar]
- 31.Kenney RM, Doig PA. Equine endometrial biopsy. In: Morrow DA, editor. Current Therapy in Theriogenology 2. Philadelphia: Saunders WB; 1986. pp. 726–729. [Google Scholar]
- 32.Hoffmann C, Ellenberger C, Mattos R, Aupperle H, Dhein S, Stief B, Schoon HA. The equine endometrosis: new insights into the pathogenesis. Anim Reprod Sci. 2009;111:261–278. doi: 10.1016/j.anireprosci.2008.03.019. [DOI] [PubMed] [Google Scholar]
- 33.Lehmann J, Ellenberger C, Hoffmann C, Bazer FW, Klug J, Allen WR. Morpho-functional studies regarding the fertility prognosis of mares suffering from equine endometrosis. Theriogenology. 2011;76:1326–1336. doi: 10.1016/j.theriogenology.2011.06.001. [DOI] [PubMed] [Google Scholar]
- 34.Szóstek AZ, Siemieniuch MJ, Lukasik K, Galvão AM, Ferreira-Dias GM, Skarzynski DJ. mRNA transcription of prostaglandin synthases and their products in the equine endometrium in the course of fibrosis. Theriogenology. 2012;78:768–776. doi: 10.1016/j.theriogenology.2012.03.024. [DOI] [PubMed] [Google Scholar]
- 35.Szóstek AZ, Lukasik K, Galvão AM, Ferreira-Dias GM, Skarzynski DJ. Impairment of the interleukin system in equine endometrium during the course of endometrosis. Biol Reprod. 2013;89:79. doi: 10.1095/biolreprod.113.109447. [DOI] [PubMed] [Google Scholar]
- 36.Woclawek-Potocka I, Kowalczyk-Zieba I, Skarzynski DJ. Lysophosphatidic acid action during early pregnancy in the cow: in vivo and in vitro studies. J Reprod Dev. 2010;56:411–420. doi: 10.1262/jrd.09-205K. [DOI] [PubMed] [Google Scholar]
- 37.Kim D, Li HY, Lee JH, Oh YS, Jun HS. Lysophosphatidic acid increases mesangial cell proliferationin models of diabetic nephropathy via Rac1/MAPK/KLF5 signaling. Exp Mol Med. 2019;51:1–10. doi: 10.1038/s12276-019-0217-3. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 38.Yasuda D, Kobayashi D, Akahoshi N, Ohto-Nakanishi T, Yoshioka K, Takuwa Y, Mizuno S, Takahashi S, Ishii S. Lysophosphatidic acid-induced YAP/TAZ activation promotes developmental angiogenesis by repressing notch ligand Dll4. J Clin Invest. 2019;129:4332–4349. doi: 10.1172/JCI121955. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 39.Liu S, Murph M, Panupinthu N, Mills GB. ATX-LPA receptor axis in inflammation and cancer. Cell Cycle. 2009;8:3695–3701. doi: 10.4161/cc.8.22.9937. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 40.Demoyer JS, Skalak TC, Durieux ME. Lysophosphatidic acid enhances healing of acute cutaneous wounds in the mouse. Wound Repair Regen. 2000;8:530–537. doi: 10.1046/j.1524-475x.2000.00530.x. [DOI] [PubMed] [Google Scholar]
- 41.Stortelers C, Kerkhoven R, Moolenaar WH. Multiple actions of lysophosphatidic acid on fibroblasts revealed by transcriptional profiling. BMC Genomics. 2008;9:387. doi: 10.1186/1471-2164-9-387. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 42.Moussad EE, Rageh MA, Wilson AK, Geisert RD, Brigstock DR. Temporal and spatial expression of connective tissue growth factor (CCN2; CTGF) and transforming growth factor beta type 1 (TGF-beta1) at the utero-placental interface during early pregnancy in the pig. Mol Pathol. 2002;55:186–192. doi: 10.1136/mp.55.3.186. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 43.Lillie B, Traficante E, Walker ME, Quinn BA, Arroyo L, Waelchli RO, Betteridge KJ, Hayes MA. Endometrial expression of capsule-associated proteins and cytokines during the third week of pregnancy in mares. Anim Reprod Sci. 2010;121:254–256. doi: 10.1016/j.anireprosci.2010.04.161. [DOI] [Google Scholar]
- 44.Hayes MA, Quinn BA, Lillie BN, Côté O, Bienzle D, Waelchli RO, Betteridge KJ. Changes in various endometrial proteins during cloprostenol-induced failure of early pregnancy in mares. Anim Reprod. 2012;9:723–741. [Google Scholar]
- 45.Klein C. Novel equine conceptus-endometrial interactions on day 16 of pregnancy based on RNA sequencing. Reprod Fertil Dev. 2016;28:1712–1720. doi: 10.1071/RD14489. [DOI] [PubMed] [Google Scholar]
- 46.Watanabe N, Ikeda H, Nakamura K. Both plasma Lysophosphatidic acid and serum Autotaxin levels are increased in chronic hepatitis C. J Clin Gastroenterol. 2007;41:616–623. doi: 10.1097/01.mcg.0000225642.90898.0e. [DOI] [PubMed] [Google Scholar]
- 47.Watanabe N, Ikeda H, Nakamura K, Ohkawa R, Kume Y. Plasma lysophosphatidic acid level and serum autotaxin activity are increased in liver injury in rats in relation to its severity. Life Sci. 2007;81:1009–1015. doi: 10.1016/j.lfs.2007.08.013. [DOI] [PubMed] [Google Scholar]
- 48.Komachi M, Damirin A, Malchinkhuu E, Mogi C, Tobo M, Ohta H, Sato K, Tomura H, Okajima F. Signaling pathways involved in DNA synthesis and migration in response to lysophosphatidic acid and low-density lipoprotein in coronary artery smooth muscle cells. Vasc Pharmacol. 2009;50:178–184. doi: 10.1016/j.vph.2009.01.004. [DOI] [PubMed] [Google Scholar]
- 49.Oga T, Matsuoka T, Yao C, Nonomura K, Kitaoka S, Sakata D, Kita Y, Tanizawa K, Taguchi Y, Chin K, Mishima M, Shimizu T, Narumiya S. Prostaglandin F2α receptor signaling facilitates bleomycin-induced pulmonary fibrosis independently of transforming growth factor- β. Nat Med. 2009;15:1426–1431. doi: 10.1038/nm.2066. [DOI] [PubMed] [Google Scholar]
- 50.Ding W, Ti Y, Wang J, Wang Z, Xie G, Shang Y, Tang M, Zhang Y, Zhang W, Zhong M. The international journal of biochemistry prostaglandin F2α facilitates collagen synthesis in cardiac fibroblasts via an F-prostanoid receptor/protein kinase C/rho kinase pathway independent of transforming growth factor 1. Int J Biochem Cell Biol. 2012;44:1031–1039. doi: 10.1016/j.biocel.2012.03.013. [DOI] [PubMed] [Google Scholar]
- 51.Aihara K, Handa T, Oga T, Watanabe K, Tanizawa K, Ikezoe K, Taguchi Y, Sato H, Chin K, Nagai S, Narumiya S, Wells AU, Mishima M. Clinical relevance of plasma prostaglandin F2α metabolite concentrations in patients with idiopathic pulmonary fibrosis. PLoS One. 2013;8:e66017. doi: 10.1371/journal.pone.0066017. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 52.Szóstek-Mioduchowska A, Baclawska A, Rebordão M, Ferreira-Dias G, Skarzynski DJ. Prostaglandins effect on matrix metallopeptidases and collagen in mare endometrial fibroblasts. Theriogenology. 2020;153:74–84. doi: 10.1016/j.theriogenology.2020.04.040. [DOI] [PubMed] [Google Scholar]
- 53.Ito Y, Goldschmeding R, Kasuga H, Claessen N, Nakayama M, Yuzawa Y, et al. Expression patterns of connective tissue growth factor and of TGF-beta isoforms during glomerular injury recapitulate glomerulogenesis. Am J Physiol Renal Physiol. 2010;299:F545–F558. doi: 10.1152/ajprenal.00120.2009. [DOI] [PubMed] [Google Scholar]
- 54.Dendooven A, Gerritsen KG, Nguyen TQ, Kok RJ, Goldschmeding R. Connective tissue growth factor (CTGF / CCN2) ELISA: a novel tool for monitoring fibrosis. Biomarkers. 2011;16:289–301. doi: 10.3109/1354750X.2011.561366. [DOI] [PubMed] [Google Scholar]
- 55.Xing X, Li Z, Yu Z, Cheng G, Li D, Li Z. Effects of connective tissue growth factor (CTGF/CCN2) on condylar chondrocyte proliferation, migration, maturation, differentiation and signaling pathway. Biochem Biophys Res Commun. 2018;495:1447–1453. doi: 10.1016/j.bbrc.2017.11.190. [DOI] [PubMed] [Google Scholar]
- 56.Hall-Glenn F, Lyons KM. Roles for CCN2 in normal physiological processes. Cell Mol Life Sci. 2011;68:3209–3217. doi: 10.1007/s00018-011-0782-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 57.Rebordão M, Galvão A, Szóstek A, Amaral A, Mateus L, Skarzynski DJ, Ferreira-Dias G. Physiopathologic mechanisms involved in mare endometrosis. Reprod Domest Anim. 2014;49:82–87. doi: 10.1111/rda.12397. [DOI] [PubMed] [Google Scholar]
- 58.Rebordão MR, Pereira C, Galvão A, Bravo PP, Szóstek A, Skarzynski DJ, Ferreira-Dias G. What is new on the physiopathology of endometrosis in the mare? Pferdeheilkunde. 2014;30:15–18. doi: 10.21836/PEM20140102. [DOI] [Google Scholar]
- 59.Roberto da Costa RP, Serrão PM, Monteiro S, Pessa P, Silva JR, Ferreira-Dias G. Caspase-3-mediated apoptosis and cell proliferation in the equine endometrium during the oestrous cycle. Reprod Fertil Dev. 2007;19:925–932. doi: 10.1071/RD06159. [DOI] [PubMed] [Google Scholar]
- 60.Rebordão MR, Amaral A, Lukasik K, Szóstek-Mioduchowska AZ, Galvão A, Skarzynski DJ, Ferreira-Dias G. Impairment of anti-fibrotic PGE2 pathway might influence neutrophil extracellular traps-induced fibrosis in mare endometrium. Domest Animal Endocrinol. 2019;67:1–10. doi: 10.1016/j.domaniend.2018.10.004. [DOI] [PubMed] [Google Scholar]
- 61.Riddle WT, LeBlanc MM, Stromberg AJ. Relationships between uterine culture, cytology and pregnancy rates in a thoroughbred practice. Theriogenology. 2007;68:395–402. doi: 10.1016/j.theriogenology.2007.05.050. [DOI] [PubMed] [Google Scholar]
- 62.Saulnier-Blache JS, Girard A, Simon MF, Lafontan M, Valet P. A simple and highly sensitive radioenzymatic assay for lysophosphatidic acid quantification. J Lipid Res. 2000;41:1947–1951. [PMC free article] [PubMed] [Google Scholar]
- 63.Szóstek-Mioduchowska AZ, Lukasik K, Skarzynski DJ, Okuda K. Effect of transforming growth factor -β1 on α-smooth muscle actin and collagen expression in equine endometrial fibroblasts. Theriogenology. 2019;124:9–17. doi: 10.1016/j.theriogenology.2018.10.005. [DOI] [PubMed] [Google Scholar]
- 64.Zhao H, Fernald RD. Comprehensive algorithm for quantitative real-time polymerase chain reaction. J Comput Biol. 2005;12:1045–1062. doi: 10.1089/cmb.2005.12.1047. [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
Data Availability Statement
The data that support the findings of this study are available from the corresponding author upon reasonable request.