Antibodies |
|
Mouse monoclonal anti-V5 |
Bio-Rad |
Cat# MCA1360 |
Mouse monoclonal anti-HA (12CA5) |
Sigma-Aldrich |
Cat# 11583816001 |
Mouse monoclonal anti-E2a (5E11) |
Abcam |
Cat# ab977 |
Rabbit polyclonal anti-Rad21 (fission yeast) |
BioAcademia |
Cat# 63-139 |
Anti-rabbit IgG (HRP-conjugated) |
GE Healthcare |
Cat# NA934-1ML |
Anti-mouse IgG (HRP-conjugated) |
GE Healthcare |
Cat# NA931 |
|
Chemicals, Peptides, and Recombinant Proteins |
|
Phenylmethylsulfonyl fluoride (PMSF) |
Sigma-Aldrich |
Cat# 11359061001 |
cOmplete EDTA-Free Protease Inhibitor Cocktail |
Sigma-Aldrich |
Cat# 11873580001 |
CLIP-Surface 547 |
New England BioLabs |
Cat# S9233S |
SNAP-Surface Alexa Fluor 647 |
New England BioLabs |
Cat# S9136S |
BC-NH2 |
New England BioLabs |
Cat# S9236S |
BG-NH2 |
New England BioLabs |
Cat# S9148S |
DTT |
Sigma-Aldrich |
Cat# 43815-5G |
BSA |
ThermoFisher |
Cat# AM2616 |
poly-dIdC:dIdC |
Sigma-Aldrich |
Cat# P4929-10UN |
biotin |
Sigma-Aldrich |
Cat# B4501-1G |
ATP |
Sigma-Aldrich |
Cat# A2383 |
ADP |
Sigma-Aldrich |
Cat# A2754 |
Beryllium sulrate tetrahydrate |
VWR international LTD |
Cat# 16104.14 |
Sodium fluoride 0.5 M Solution |
Sigma-Aldrich |
Cat# 67414-1ML-F |
Aluminum chloride |
Sigma-Aldrich |
Cat# 449598-5G |
Sodium Orthovanadate |
New England BioLabs |
Cat# P0758S |
InstantBlue |
Sigma-Aldrich |
Cat# ISB1L-1L |
SYBR Gold Nucleic Acid Gel Stain |
ThermoFisher |
Cat# S11494 |
Protease K |
TaKaRa |
Cat# 9034 |
AcTEV protease |
ThermoFisher |
Cat# 12575015 |
PstI-HF |
New England BioLabs |
Cat# R3140S |
T7 DNA polymerase |
New England BioLabs |
Cat# M0274S |
CloneAmp HiFi PCR Premix |
TaKaRa |
Cat# 639298 |
GoTaq Taq G2 DNA Polymerase |
Promega |
Cat# M7845 |
Deoxynucleotide Set |
Sigma-Aldrich |
Cat# DNTP100-1KT |
Aminoallyl-dUTP |
Stratech Scientific Ltd |
Cat# NU-803S-JEN-10ul |
SDAD (NHS-SS-Diazirine) |
ThermoFisher |
Cat# 26169 |
SDA (NHS-Diazirine) |
ThermoFisher |
Cat# 26167 |
Lysyl EndopeptidaseR (Lys-C) |
FUJIFILM |
Cat# 129-02541 |
Ammonium bicarbonate |
Sigma-Aldrich |
Cat# 09830-500G |
Fission yeast cohesin (Psm1-Psm3-Rad21-Psc3) |
Murayama and Uhlmann, 2014 |
N/A |
Fission yeast EQ-cohesin (Psm1E1161Q-Psm3E1128Q- Rad21-Psc3) |
Murayama and Uhlmann, 2015 |
N/A |
Fission yeast KKQQ cohesin (Psm1-Psm3K105Q/K106Q- Rad21-Psc3) |
Murayama and Uhlmann, 2015 |
N/A |
Fission yeast Mis4-Ssl3 |
Murayama and Uhlmann, 2014 |
N/A |
Fission yeast Mis4 N-191 |
Chao et al., 2015 |
N/A |
Fission yeast Pds5 |
Murayama and Uhlmann, 2015 |
N/A |
Fission yeast Wapl |
Murayama and Uhlmann, 2015 |
N/A |
|
Critical Commercial Assays |
|
SilverQuest Silver Staining Kit |
ThermoFisher |
Cat# LC6070 |
InFusion HD cloning kit |
TaKaRa |
Cat# 638910 |
Human IgG-Agarose |
Sigma-Aldrich |
Cat# A6284-5ML |
Glutathione Sepharose 4B |
GE Healthcare |
Cat# 17075601 |
Ni-NTA Superflow (25 ml) |
QIAGEN |
Cat# 30410 |
HiTrap Heparin HP 1 ml |
GE Healthcare |
Cat# 17040601 |
Superdex 200 Increase 10/300 GL |
GE Healthcare |
Cat# 28990944 |
Superdex 75 Increase 10/300GL |
GE Healthcare |
Cat# 29148721 |
Superose 6, 10/300 GL |
GE Healthcare |
Cat# 17517201 |
Amicon Ultra-4 centrifuge filter unit |
Sigma-Aldrich |
Cat# UFC810096 |
Slide-A-Lyzer MINI Dialysis Devices, 20K MWCO |
ThermoFisher |
Cat# 69555 |
Dynabeads M-280 Streptavidin |
ThermoFisher |
Cat#11206D |
Dynabeads Protein A |
ThermoFisher |
Cat#10002D |
ECL Prime Western Blotting Detection Regent |
GE Healthcare |
Cat# RPN2232 |
Zeba Spin Desalting Columns, 7K MWCO, 0.5 mL |
ThermoFisher |
Cat# 89882 |
MICROSPIN S-400 HR, 50 COLUMNS |
GE Healthcare |
Cat#GE27-5140-01 |
TLC PEI Cellulose F |
Merck |
Cat#105725 |
|
Experimental Models: Organisms/Strains |
|
All yeast strains used in this study are listed in Table S1. |
Lab stock and this study |
N/A |
Escherichia coli: BL21 (DE3) codonPlus RIPL chemical competent cells |
Agilent Technologies |
Cat#230280 |
|
Oligonucleotides |
|
TH1:[bioteg]agcgcagcgagtcagtgagcgagg |
Sigma-Aldrich |
N/A |
TH2:cggtcgttcggctgcggcgagcgg |
Sigma-Aldrich |
N/A |
TH3: [bioteg]cggtcgttcggctgcggcgagcgg |
Sigma-Aldrich |
N/A |
TH4:agcgcagcgagtcagtgagcgagg |
Sigma-Aldrich |
N/A |
TH5:cctttttacggttcctggcc |
Sigma-Aldrich |
N/A |
|
Recombinant DNA |
|
pBluescript II KS(+) |
Murayama and Uhlmann, 2014, 2015, Murayama et al., 2018
|
N/A |
ssDNA of pBluescript II KS(+) |
Murayama et al., 2018 |
N/A |
M13KO7 Helper Phage |
New England BioLabs |
Cat# N0315S |
JM109 competent cells |
New England BioLabs |
Cat#E4107 |
Plasmid: pMis4-PA |
Murayama and Uhlmann, 2014 |
N/A |
Plasmid: pMis4-N191-PA |
Chao et al., 2015 |
N/A |
Plasmid: pSsl3 |
Murayama and Uhlmann, 2014 |
N/A |
Plasmid: pGEX-Wapl |
Murayama and Uhlmann, 2015 |
N/A |
|
Software and Algorithms |
|
Fiji ImageJ |
open source |
https://imagej.net/Fiji |
UCSF ChimeraX |
Resource for Biocomputing Visualization, and Informatics |
https://www.cgl.ucsf.edu/chimerax/ |
PyMOL |
Schrodinger |
https://pymol.org/2/ |
PEAKS X+ |
Bioinfomatics Solutions Inc. |
https://www.bioinfor.com/peaks-studio-x-plus/ |
xiVIEW |
Rappsilber lab |
https://xiview.org/xiNET_website/index.php |
CCBuilder 2.0 |
open source |
http://coiledcoils.chm.bris.ac.uk/ccbuilder2/builder |
Clustal Omega |
open source |
https://www.ebi.ac.uk/Tools/msa/clustalo/ |
|
Deposited Data |
|
Protein-protein crosslink mass spectrometry (CLMS) data |
PRIDE |
PXD018608 |
DNA-protein crosslink mass spectrometry (DPC-MS) |
PRIDE |
PXD018600 |
Negative stain EM map |
EMDB |
EMD-10870 |
cryo-EM map |
EMDB |
EMD-10930 |
cryo-EM atomic coordinates |
PDB |
6YUF |
Unprocessed gel images presented in this manuscript can be found at https://data.mendeley.com/datasets/9bddfnc7wb/draft?a=41d6ea5b-4cba-4f3e-b9f3-a42dfb09eff4
|
N/A |
N/A |