REAGENT or RESOURCE	SOURCE	IDENTIFIER
Antibodies
Mouse monoclonal anti-V5	Bio-Rad	Cat# MCA1360
Mouse monoclonal anti-HA (12CA5)	Sigma-Aldrich	Cat# 11583816001
Mouse monoclonal anti-E2a (5E11)	Abcam	Cat# ab977
Rabbit polyclonal anti-Rad21 (fission yeast)	BioAcademia	Cat# 63-139
Anti-rabbit IgG (HRP-conjugated)	GE Healthcare	Cat# NA934-1ML
Anti-mouse IgG (HRP-conjugated)	GE Healthcare	Cat# NA931
Chemicals, Peptides, and Recombinant Proteins
Phenylmethylsulfonyl fluoride (PMSF)	Sigma-Aldrich	Cat# 11359061001
cOmplete EDTA-Free Protease Inhibitor Cocktail	Sigma-Aldrich	Cat# 11873580001
CLIP-Surface 547	New England BioLabs	Cat# S9233S
SNAP-Surface Alexa Fluor 647	New England BioLabs	Cat# S9136S
BC-NH2	New England BioLabs	Cat# S9236S
BG-NH2	New England BioLabs	Cat# S9148S
DTT	Sigma-Aldrich	Cat# 43815-5G
BSA	ThermoFisher	Cat# AM2616
poly-dIdC:dIdC	Sigma-Aldrich	Cat# P4929-10UN
biotin	Sigma-Aldrich	Cat# B4501-1G
ATP	Sigma-Aldrich	Cat# A2383
ADP	Sigma-Aldrich	Cat# A2754
Beryllium sulrate tetrahydrate	VWR international LTD	Cat# 16104.14
Sodium fluoride 0.5 M Solution	Sigma-Aldrich	Cat# 67414-1ML-F
Aluminum chloride	Sigma-Aldrich	Cat# 449598-5G
Sodium Orthovanadate	New England BioLabs	Cat# P0758S
InstantBlue	Sigma-Aldrich	Cat# ISB1L-1L
SYBR Gold Nucleic Acid Gel Stain	ThermoFisher	Cat# S11494
Protease K	TaKaRa	Cat# 9034
AcTEV protease	ThermoFisher	Cat# 12575015
PstI-HF	New England BioLabs	Cat# R3140S
T7 DNA polymerase	New England BioLabs	Cat# M0274S
CloneAmp HiFi PCR Premix	TaKaRa	Cat# 639298
GoTaq Taq G2 DNA Polymerase	Promega	Cat# M7845
Deoxynucleotide Set	Sigma-Aldrich	Cat# DNTP100-1KT
Aminoallyl-dUTP	Stratech Scientific Ltd	Cat# NU-803S-JEN-10ul
SDAD (NHS-SS-Diazirine)	ThermoFisher	Cat# 26169
SDA (NHS-Diazirine)	ThermoFisher	Cat# 26167
Lysyl EndopeptidaseR (Lys-C)	FUJIFILM	Cat# 129-02541
Ammonium bicarbonate	Sigma-Aldrich	Cat# 09830-500G
Fission yeast cohesin (Psm1-Psm3-Rad21-Psc3)	Murayama and Uhlmann, 2014	N/A
Fission yeast EQ-cohesin (Psm1E1161Q-Psm3E1128Q- Rad21-Psc3)	Murayama and Uhlmann, 2015	N/A
Fission yeast KKQQ cohesin (Psm1-Psm3K105Q/K106Q- Rad21-Psc3)	Murayama and Uhlmann, 2015	N/A
Fission yeast Mis4-Ssl3	Murayama and Uhlmann, 2014	N/A
Fission yeast Mis4 N-191	Chao et al., 2015	N/A
Fission yeast Pds5	Murayama and Uhlmann, 2015	N/A
Fission yeast Wapl	Murayama and Uhlmann, 2015	N/A
Critical Commercial Assays
SilverQuest Silver Staining Kit	ThermoFisher	Cat# LC6070
InFusion HD cloning kit	TaKaRa	Cat# 638910
Human IgG-Agarose	Sigma-Aldrich	Cat# A6284-5ML
Glutathione Sepharose 4B	GE Healthcare	Cat# 17075601
Ni-NTA Superflow (25 ml)	QIAGEN	Cat# 30410
HiTrap Heparin HP 1 ml	GE Healthcare	Cat# 17040601
Superdex 200 Increase 10/300 GL	GE Healthcare	Cat# 28990944
Superdex 75 Increase 10/300GL	GE Healthcare	Cat# 29148721
Superose 6, 10/300 GL	GE Healthcare	Cat# 17517201
Amicon Ultra-4 centrifuge filter unit	Sigma-Aldrich	Cat# UFC810096
Slide-A-Lyzer MINI Dialysis Devices, 20K MWCO	ThermoFisher	Cat# 69555
Dynabeads M-280 Streptavidin	ThermoFisher	Cat#11206D
Dynabeads Protein A	ThermoFisher	Cat#10002D
ECL Prime Western Blotting Detection Regent	GE Healthcare	Cat# RPN2232
Zeba Spin Desalting Columns, 7K MWCO, 0.5 mL	ThermoFisher	Cat# 89882
MICROSPIN S-400 HR, 50 COLUMNS	GE Healthcare	Cat#GE27-5140-01
TLC PEI Cellulose F	Merck	Cat#105725
Experimental Models: Organisms/Strains
All yeast strains used in this study are listed in Table S1.	Lab stock and this study	N/A
Escherichia coli: BL21 (DE3) codonPlus RIPL chemical competent cells	Agilent Technologies	Cat#230280
Oligonucleotides
TH1:[bioteg]agcgcagcgagtcagtgagcgagg	Sigma-Aldrich	N/A
TH2:cggtcgttcggctgcggcgagcgg	Sigma-Aldrich	N/A
TH3: [bioteg]cggtcgttcggctgcggcgagcgg	Sigma-Aldrich	N/A
TH4:agcgcagcgagtcagtgagcgagg	Sigma-Aldrich	N/A
TH5:cctttttacggttcctggcc	Sigma-Aldrich	N/A
Recombinant DNA
pBluescript II KS(+)	Murayama and Uhlmann, 2014, 2015, Murayama et al., 2018	N/A
ssDNA of pBluescript II KS(+)	Murayama et al., 2018	N/A
M13KO7 Helper Phage	New England BioLabs	Cat# N0315S
JM109 competent cells	New England BioLabs	Cat#E4107
Plasmid: pMis4-PA	Murayama and Uhlmann, 2014	N/A
Plasmid: pMis4-N191-PA	Chao et al., 2015	N/A
Plasmid: pSsl3	Murayama and Uhlmann, 2014	N/A
Plasmid: pGEX-Wapl	Murayama and Uhlmann, 2015	N/A
Software and Algorithms
Fiji ImageJ	open source	https://imagej.net/Fiji
UCSF ChimeraX	Resource for Biocomputing Visualization, and Informatics	https://www.cgl.ucsf.edu/chimerax/
PyMOL	Schrodinger	https://pymol.org/2/
PEAKS X+	Bioinfomatics Solutions Inc.	https://www.bioinfor.com/peaks-studio-x-plus/
xiVIEW	Rappsilber lab	https://xiview.org/xiNET_website/index.php
CCBuilder 2.0	open source	http://coiledcoils.chm.bris.ac.uk/ccbuilder2/builder
Clustal Omega	open source	https://www.ebi.ac.uk/Tools/msa/clustalo/
Deposited Data
Protein-protein crosslink mass spectrometry (CLMS) data	PRIDE	PXD018608
DNA-protein crosslink mass spectrometry (DPC-MS)	PRIDE	PXD018600
Negative stain EM map	EMDB	EMD-10870
cryo-EM map	EMDB	EMD-10930
cryo-EM atomic coordinates	PDB	6YUF
Unprocessed gel images presented in this manuscript can be found at https://data.mendeley.com/datasets/9bddfnc7wb/draft?a=41d6ea5b-4cba-4f3e-b9f3-a42dfb09eff4	N/A	N/A