Key resources table.
| Reagent type (species) or resource |
Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Strain, strain background (R. norvegicus, male and female) | Sprague-Dawley Crl: CD(SD) | Charles River Laboratories | RRID:RGD_734476 | University of Edinburgh maintained colony |
| Strain, strain background (M. musculus, male and female) |
Nfasc-/- mice Background: C57BL/6JOla |
Sherman et al., 2005 | Peter Brophy, University of Edinburgh | |
| Strain, strain background (M. musculus, male and female) | L7-SEP-Nfasc186 Background: C57BL/6JOla |
This paper | Peter Brophy, University of Edinburgh | |
| Transfected construct (M. musculus) | SEP-Nfasc186-pCMV5a | This paper | Peter Brophy, University of Edinburgh | |
| Transfected construct (M. musculus) | SEP-Nfasc186YA-pCMV5a | This paper | Peter Brophy, University of Edinburgh | |
| Transfected construct (M. musculus) | Nfasc186-mCh-pCMV5a | This paper | Peter Brophy, University of Edinburgh | |
| Transfected construct (M. musculus) | Nfasc186-Dendra2-pCMV5a | This paper | Peter Brophy, University of Edinburgh | |
| Transfected construct (human) | SEP-Kv7.3-pCDNA3.1 | Benned-Jensen et al., 2016 | Nicole Schmitt, University of Copenhagen | |
| Transfected construct (human) | Kv-7.2-pXOOM | Benned-Jensen et al., 2016 | Nicole Schmitt, University of Copenhagen | |
| Transfected construct (R. norvegicus) | AnkG-mCh | Addgene Leterrier et al., 2011 | plasmid #42566 | |
| Transfected construct (human) | KHC560-halo | Twelvetrees et al., 2016 | Alison Twelvetrees, University of Sheffield |
|
| Antibody | Neurofascin (rabbit polyclonal) | Tait et al., 2000 | Intracellular epitope IF (1:1000) |
|
| Antibody | Neurofascin (mouse monoclonal) | UC Davis/NIH NeuroMab | clone: A12/18 | Extracellular epitope IF (1:10) |
| Antibody | ßIV spectrin (rabbit polyclonal) | Zonta et al., 2011 | IF (1:200) | |
| Antibody | GFP (chicken polyclonal) | Abcam | Cat# ab13970 | IF (1:1000) |
| Antibody | Ankyrin G (mouse monoclonal) | UC Davis/NIH NeuroMab | clone: N106/65 | IF (1:30) |
| Antibody | Anti-Rabbit Alexa Fluor 594 | Jackson ImmunoResearch | Cat# 111-585-14 | IF (1:1000) |
| Antibody | Anti-Chicken Alexa Fluor 488 | Jackson ImmunoResearch | Cat# 703-545-155 | IF (1:1000) |
| Antibody | Anti-Mouse IgG2a Alexa Fluor 488 | Invitrogen | Cat# A-21131 | IF (1:1000) |
| Antibody | Anti-Mouse IgG2b Alexa Fluor 568 | Invitrogen | Cat# A-21144 | IF (1:1000) |
| Chemical compound, drug | Phusion High-Fidelity DNA Polymerase | New England BioLabs | Cat# M0530S | |
| Chemical compound, drug | T4 DNA Ligase | Thermo Fisher Scientific | Cat# EL0011 | |
| Chemical compound, drug | DpnI | New England BioLabs | Cat# R0176S | |
| Chemical compound, drug | Lipofectamine 2000 Transfection Reagent | Thermo Fisher Scientific | Cat#11668030 | |
| Chemical compound, drug | DMSO | Sigma-Aldrich | Cat# 434302 | |
| Chemical compound, drug | Poly-D-lysine | Sigma-Aldrich | Cat# P6407 | |
| Chemical compound, drug | B-27 | Thermo Fisher Scientific | Cat# 17504044 | |
| Chemical compound, drug | Fish skin gelatin | Sigma-Aldrich | Cat# G7765 | |
| Chemical compound, drug | Nocodazole | Sigma-Aldrich | Cat# SML1665 | |
| Chemical compound, drug | Latrunculin A | Merck | Cat# 428026 | |
| Chemical compound, drug | (S)-nitro-Blebbistatin | Cayman Chemical | Cat# 85692575–2 | |
| Chemical compound, drug | JF549-Halo Tag Ligand | Janelia Research Campus Grimm et al., 2017 |
||
| Sequence-based reagent | Mutagenesis primer one to insert AgeI site in Nfasc cDNA | Integrated DNA Technologies | This paper | GAATGAGCTGACCGGTCAACCCCCAACTATCAC |
| Sequence-based reagent | Mutagenesis primer two to insert AgeI site in Nfasc cDNA | Integrated DNA Technologies | This paper | GGGGGTTGACCGGTCAGCTCATTCTGAATGCTTG |
| Sequence-based reagent | Mutagenesis primer one to generate Nfasc186YA | Integrated DNA Technologies | This paper | AAGGAGCCATCTTCATTG |
| Sequence-based reagent | Mutagenesis primer two to generate Nfasc186YA | Integrated DNA Technologies | This paper | TATTGGCCAGGCCACTGTCAAAAAG |
| Sequence-based reagent | Dendra2-HindIII-fwd | Integrated DNA Technologies | This paper | AAAAAGCTTGGAGGAACCATGAACACCCCGGGAATTAACC |
| Sequence-based reagent | Dendra2-SalI-rev | Integrated DNA Technologies | This paper | TTTGTCGAC TCACCACACCTGGCTGGGCA |
| Software, algorithm | FIJI | Schindelin et al., 2012 | RRID:SCR_002285 | https://imagej.net/Fiji |
| Software, algorithm | Prism 6.0 | GraphPad | RRID:SCR_002798 | |
| Software, algorithm | KymoTool Box | Zala et al., 2013 | Frédéric Saudou, University of Grenoble Alpes |