Structural analysis of the Legionella pneumophila Dot/Icm type IV secretion system core complex

Clarissa L Durie; Michael J Sheedlo; Jeong Min Chung; Brenda G Byrne; Min Su; Thomas Knight; Michele Swanson; D Borden Lacy; Melanie D Ohi

doi:10.7554/eLife.59530

. 2020 Sep 2;9:e59530. doi: 10.7554/eLife.59530

Structural analysis of the Legionella pneumophila Dot/Icm type IV secretion system core complex

Clarissa L Durie ^1,^†, Michael J Sheedlo ^2,^†, Jeong Min Chung ¹, Brenda G Byrne ³, Min Su ¹, Thomas Knight ³, Michele Swanson ^3,^✉, D Borden Lacy ^2,^4,^5,^✉, Melanie D Ohi ^1,^✉

Editors: Andrew P Carter⁶, John Kuriyan⁷

PMCID: PMC7511231 PMID: 32876045

Abstract

Legionella pneumophila is an opportunistic pathogen that causes the potentially fatal pneumonia Legionnaires’ Disease. This infection and subsequent pathology require the Dot/Icm Type IV Secretion System (T4SS) to deliver effector proteins into host cells. Compared to prototypical T4SSs, the Dot/Icm assembly is much larger, containing ~27 different components including a core complex reported to be composed of five proteins: DotC, DotD, DotF, DotG, and DotH. Using single particle cryo-electron microscopy (cryo-EM), we report reconstructions of the core complex of the Dot/Icm T4SS that includes a symmetry mismatch between distinct structural features of the outer membrane cap (OMC) and periplasmic ring (PR). We present models of known core complex proteins, DotC, DotD, and DotH, and two structurally similar proteins within the core complex, DotK and Lpg0657. This analysis reveals the stoichiometry and contact interfaces between the key proteins of the Dot/Icm T4SS core complex and provides a framework for understanding a complex molecular machine.

Research organism: Other

Introduction

The Type IV Secretion System (T4SS) is a potent weapon used by some bacteria to infect their host and can deliver effector proteins into eukaryotic cells as well as DNA and/or toxins into bacterial neighbors (Grohmann et al., 2018; Cascales and Christie, 2003; Fronzes et al., 2009). T4SSs are deployed by a variety of human pathogens, such as Legionella pneumophila, Helicobacter pylori, and Bordetella pertussis (Grohmann et al., 2018; Cascales and Christie, 2003; Fronzes et al., 2009). In the Gram-negative pathogen L. pneumophila, the Dot/Icm T4SS (Schroeder, 2017) delivers ~300 effector proteins to the cytoplasm of host cells, in some cases causing Legionnaires’ Disease (Schroeder, 2017; Swanson and Hammer, 2000; Molofsky and Swanson, 2004). The T4SSs of Gram-negative bacteria are organized into an inner membrane complex, a core complex that spans the periplasmic space, and in some species an extracellular pilus (Grohmann et al., 2018; Fronzes et al., 2009; Waksman, 2019; Low et al., 2014; Christie et al., 2014). These T4SSs vary in complexity with some species requiring only 12 components to assemble the complete apparatus. Some systems, such as the Dot/Icm T4SS of L. pneumophila and the Cag T4SS of H. pylori, are much larger and are constructed from over 20 different proteins, many of which are species-specific (Chung et al., 2019; Purcell and Shuman, 1998).

The current structural understanding of the large T4SSs has been limited to comparisons to minimized, prototype systems from Xanthomonas citri and the pKM101 conjugation system (referred to herein as pKM101). These studies have revealed homologous core structures that are comprised of three components known as VirB7, VirB9 and VirB10 (Chung et al., 2019; Sgro et al., 2018; Rivera-Calzada et al., 2013; Chandran et al., 2009). Previous cryo-electron tomography (cryo-ET) studies on the Dot/Icm T4SS have suggested a similar arrangement of some components of this system though no high-resolution data of the intact complex have been obtained to date (Ghosal et al., 2017; Ghosal et al., 2019; Chetrit et al., 2018; Park et al., 2020).

Results and discussion

Towards obtaining a high resolution understanding of the Dot/Icm T4SS we purified from L. pneumophila intact core complex particles as evident from negative stain electron microscopy, as previously described (Kubori and Nagai, 2019; Figure 1—figure supplement 1A). Central to assembly of the apparatus are five proteins that define the core complex: DotC, DotD, DotF, DotG, and DotH (Ghosal et al., 2017; Ghosal et al., 2019; Kubori et al., 2014; Nagai and Kubori, 2011). Mass spectrometry analysis of the purification verified the presence of these predicted core components (Ghosal et al., 2019; Kubori and Nagai, 2019; Kubori et al., 2014; Vincent et al., 2006), as well as additional proteins identified in dot (defect in organelle trafficking) or icm (intra-cellular multiplication) genetic screens (Segal et al., 1998; Segal and Shuman, 1999; Vogel et al., 1998; Table 1). We vitrified this sample and, although particles adopt a preferred orientation in vitrified ice, both en face and side views are observed, allowing for 3D reconstruction (Figure 1A, Figure 1—figure supplement 1B,C, and Figure 1—figure supplement 2). The Dot/Icm T4SS is ~400 Å wide and ~165 Å long, consistent in shape and size with T4SS complexes visualized in intact L. pneumophila using cryo-ET (Ghosal et al., 2017; Ghosal et al., 2019; Chetrit et al., 2018; Park et al., 2020; Figure 1B). The global resolution of the map without imposed symmetry is 4.6 Å, with the highest resolution regions near its center (Figure 1—figure supplement 1D,E). The map can be divided into two major regions: an outer membrane cap (OMC) and a hollow periplasmic ring (PR). The OMC can be further subdivided into two features, a central dome and a flat disk containing 13 arms that extend radially outward (Figure 1A,C,D). While cryo-ET analysis of the Dot/Icm T4SS in intact cells included a stalk bridging the PR and the inner membrane (Ghosal et al., 2019), this portion of the complex is not observed in the reconstruction of the purified T4SS, likely due to dissociation during purification. An axial section through the map in Figure 1B,D reveals a large cavity running through the T4SS, starting from the bottom of the PR and extending to the OMC region that spans the outer membrane, although there appears to be density in the central cavity closest to the outer membrane. This is perhaps the ‘plug’ seen in the cryo-ET analysis of in situ T4SS (Ghosal et al., 2019).

Table 1. Dot proteins present in isolated complex sample isolated from wild type strain (Lp02).

		Spectral Counts^†
Identified proteins	Gene Number*	Prep 1	Prep 2	Prep 3
DotG^‡	Q5ZYC1	112	114	195
DotF	Q5ZYC0	94	69	101
DotA	Q5ZS33	38	65	60
DotO	Q5ZYB6	37	38	47
DotH	Q5ZYC2	28	19	28
IcmF	Q5ZYB4	15	18	36
IcmX	Q5ZS30	19	13	28
DotL	Q5ZYC6	10	26	20
DotC	Q5ZS44	9	11	16
DotD	Q5ZS45	11	9	14
DotB	Q5ZS43	16	11	7
Lpg0657	Q5ZXS4	6	4	16
DotM	Q5ZYC7	2	14	3
DotK	Q5ZYC5	2	6	10
IcmW	Q5ZS31	5	7	5
DotN	Q5ZYB7	2	6	4
DotI	Q5ZYC3	1	3	5
IcmS	Q5ZYD0		4	1
IcmT	Q5ZYD1	1	1	3
IcmV	Q5ZS32	1	1	2

Open in a new tab

*UniProtKB Accession Number.

^†Proteins were identified by searching the MS/MS data against L. pneumophila (UniProt; 2930 entries) using Proteome Discoverer (v2.1, Thermo Scientific). Search parameters included MS1 mass tolerance of 10 ppm and fragment tolerance of 0.1 Da. False discovery rate (FDR) was determined using Percolator and proteins/peptides with a FDR of ≤1% were retained for further analysis. Complete results are in Supplementary file 1 in supplementary material.

^‡Predicted core T4SS components and additional components identified in this structure are in bold.

Figure 1. — (a) Reconstruction of the *L. pneumophila* Dot/Icm T4SS particles at 4.6 Å with no symmetry applied reveals two parts, the outer membrane cap (OMC), composed of a central dome and flat disk, and a periplasmic ring (PR). (b) Comparison of the central sections through the longitudinal plane of the T4SS 3D density determined by cryo-ET of intact *L. pneumophila* (left panel, EMD 0566) (Ghosal et al., 2019) with arrow indicating plug density or by cryo-EM of purified particles (this study) (right panel). OM, Outer Membrane, IM, Inner Membrane, Scale bar 10 nm. (c) Combined high resolution structures of the *L. pneumophila* Dot/Icm T4SS that include the 3.5 Å OMC disk (blue) with 13-fold symmetry and the 3.7 Å PR (green) with 18-fold symmetry. (d) Central axial slice view showing how atomic models of the OMC disk (blue) and PR (green) fit into the C1 3D map of the Dot/Icm T4SS (light gray).

Figure 1—figure supplement 1. — (a) Reconstruction of the *L. pneumophila* Dot/Icm T4SS particles at 4.6 Å with no symmetry applied reveals two parts, the outer membrane cap (OMC), composed of a central dome and flat disk, and a periplasmic ring (PR). (b) Comparison of the central sections through the longitudinal plane of the T4SS 3D density determined by cryo-ET of intact *L. pneumophila* (left panel, EMD 0566) (Ghosal et al., 2019) with arrow indicating plug density or by cryo-EM of purified particles (this study) (right panel). OM, Outer Membrane, IM, Inner Membrane, Scale bar 10 nm. (c) Combined high resolution structures of the *L. pneumophila* Dot/Icm T4SS that include the 3.5 Å OMC disk (blue) with 13-fold symmetry and the 3.7 Å PR (green) with 18-fold symmetry. (d) Central axial slice view showing how atomic models of the OMC disk (blue) and PR (green) fit into the C1 3D map of the Dot/Icm T4SS (light gray).

The dome of the T4SS OMC is positioned within the center of the map and is about ~50 Å high and ~100 Å wide. Attempts to refine the dome by imposing different symmetries did not improve the resolution; therefore no clear symmetry was defined. In other T4SSs that have been structurally characterized, the dome is a contiguous part of the OMC, shares the same symmetry, and is clearly composed of organized α-helices (Chung et al., 2019; Sgro et al., 2018; Chandran et al., 2009). While we do not see individual helices in our map, in the C1 reconstruction the narrow opening of the L. pneumophila dome is ~40 Å in diameter, a dimension within the range of pore sizes observed in the OMC of other species (Figure 1A; Chung et al., 2019; Sgro et al., 2018; Chandran et al., 2009).

Using symmetry and focused refinement, we determined a 3.5 Å resolution map of the OMC disk and a 3.7 Å map of the PR (Figure 1C, Figure 1—figure supplement 2, and Figure 1—figure supplement 3). Notably, while the disk exhibits the expected 13-fold symmetry observed previously (Ghosal et al., 2017; Ghosal et al., 2019; Chetrit et al., 2018; Park et al., 2020; Hu et al., 2019), the PR contains 18-fold symmetry (Figure 1C and Figure 1—figure supplement 3A,D). While the possibility of this symmetry mismatch was postulated from low-resolution in situ structures of the Dot/Icm T4SS (Park et al., 2020), the symmetry of the different regions was not determined. Interestingly, a similar symmetry mismatch occurs between the H. pylori T4SS OMC and PR: its OMC contains 14-fold symmetry while the PR has 17-fold symmetry (Chung et al., 2019). The resolution of the Dot/Icm T4SS OMC disk and PR maps made it possible to construct models of the proteins in these regions (Figure 1C,D).

The OMC disk makes up the pinwheel-shaped portion of the T4SS and is organized into a thick central region with 13 arms extending radially outward (Figure 2A). The disk is ~75 Å along the axial dimension with an interior chamber ~150 Å wide. The disk is also thin compared to other structurally characterized T4SS OMCs and contains no distinct inner or outer layers (Chung et al., 2019; Sgro et al., 2018; Chandran et al., 2009). Within the disk, we unambiguously traced and identified DotC, DotD, DotK and DotH along with the protein Lpg0657 (Goodwin et al., 2016; Figure 2B, Figure 2—figure supplements 1 and 2). Of these, only structures of the C-terminal domain of DotD (PDB 3ADY) and the structure of Lpg0657 (PDB 3LDT) had been previously reported (Nakano et al., 2010). Notably, rather than an equimolar ratio, the components of the OMC exist at a ratio of 2:1:1:1:1 (DotD:DotC:DotH:DotK:Lpg0657) (Figure 2B).

Figure 2. — (a) The OMC disk of the Dot/Icm T4SS was reconstructed from samples that were purified from the WT strain (b) We have defined an asymmetric unit that is comprised of DotC (brown), DotD₁ (red), DotD₂ (salmon), DotH (orange), DotK (cyan), Lpg0657 (blue), and three unknown chains (gray).

Figure 2—figure supplement 1. — (a) The OMC disk of the Dot/Icm T4SS was reconstructed from samples that were purified from the WT strain (b) We have defined an asymmetric unit that is comprised of DotC (brown), DotD₁ (red), DotD₂ (salmon), DotH (orange), DotK (cyan), Lpg0657 (blue), and three unknown chains (gray).

At the center of the OMC is an elongated fold that is comprised of α-helices and β-strands that we have identified as DotC (residues 58–161 and 173–268). DotC is folded such that two large α-helices protrude toward the outer membrane and are flanked on either side by two β-strands (Figure 3A). The two β-strands adjacent to the central α-helices fold into a nearly uninterrupted β-sheet that is formed between asymmetric units and consists of a generally hydrophilic surface that runs about the central cavity (Figure 3B). When docked into the asymmetric reconstruction, this β-sheet lines the poorly resolved central section of the map. From these data, the only clear contact that is made between DotC and the central pore is a small interface at the top of the two long α-helices, which may explain why this portion is not well resolved in the maps (Figure 3C). A search of the protein data bank yielded a wide array of potential structural homologs, including a number of channels and transporters; most of these share little homology to DotC overall (Holm, 2019). On the peripheral side, DotC makes contact with two copies of DotD, which we have called DotD₁ and DotD₂ (Figure 4A–C). The core folds of these proteins are similar to that of other components of large bacterial complexes such as VirB7 homologs from other T4SSs as well as components of type four pilus systems (Figure 4D). The interface between the two copies of DotD is mediated by electrostatic interactions and hydrogen bonds (Figure 4E). The N-terminus, which was not fully visualized in the previously reported DotD crystal structure (Nakano et al., 2010), is α-helical and extends from the middle of the disk toward the pore, forming a dimer that interacts with the central α-helices of DotC (Figure 4F).

Figure 3. — (a) DotC is composed of two large α-helices and two β-sheets. (b) These sheets are formed between asymmetric units and comprise a predominantly electrostatic structure that lines the central chamber. (c) DotC is adjacent to the poorly resolved portion of the C1 map (circled with a red dotted line, left). The positioning of DotC is such that a gap exists between it and the asymmetric portion of the map (brown dotted line, center). This results in a small predicted interface between DotC and the central dome (right).

Figure 4. — (**a–b**) On the peripheral side, DotC is observed with two copies of DotD, shown in red and salmon. (c) The two copies of DotD vary little in their overall organization, deviating by an RMSD of only 0.6 Å within the C-terminal domain as shown in the inset. (d) Both copies of DotD observed within this map adopt a fold that is similar to the previously reported crystal structure as well as related VirB7 homologs. (e) The interface that is formed between DotD₁ and DotD₂ is formed by a number of electrostatic and polar interactions as shown in the inset. (f) The N-terminal α-helices of DotD₁ and DotD₂ form the bulk of the interface observed with DotC, made up of a hydrophobic interface as shown in the inset.

Adjacent to the N-terminus of DotD we have modeled a small globular fold that we have identified as DotK. DotK is positioned adjacent to the outer membrane, consistent with previous studies (Figure 5A,B; Ghosal et al., 2019). By chain tracing, we identified a second, similar fold near DotK. After docking the structure of DotK into the density, we noted that although the model fits well globally, some portions of the model were not supported by the density locally. Therefore, we initiated a DALI search for structurally similar molecules that identified Lpg0657 (PDB 3LDT) as a structural homolog and candidate for this density (Holm, 2019; Figure 5A–D). Though Lpg0657 has not been shown to directly interact with the Dot/Icm T4SS in prior studies, it is vital for L. pneumophila replication in vitro (Goodwin et al., 2016). In fact, Goodwin and colleagues hypothesized that Lpg0657 might interact with the Dot/Icm T4SS (Goodwin et al., 2016). Upon refining this model into the density, we noted that all features of Lpg0657 fit well into the density both globally and locally (Figure 5E). The presence of Lpg0657 is corroborated by mass spectrometry data of this sample (Table 1). The structures of both DotK and Lpg0657 resemble peptidoglycan binding domains (Lin et al., 2019); however, density corresponding to peptidoglycan was not observed within the binding cleft in either DotK or Lpg0657, and several key residues known to mediate peptidoglycan interactions are not present. Thus, we suspect that neither protein mediates direct interaction with peptidoglycan. Notably, although the two proteins share a similar fold, they make contact with different members of the T4SS. DotK contacts the C-terminal domain of DotD₂, whereas Lpg0657 interacts with the N-terminal α-helices of both DotD₁ and DotD₂. This architecture is likely due to differences in the primary sequences of DotK and Lpg0657 that dictate the arrangement of these two similar proteins within the apparatus.

Figure 5. — (a) Two nearly identical folds were discovered on the outer membrane side of the OMC that correspond to DotK (cyan) and Lpg0657 (blue). (b) DotK and Lpg0657 arrange such that each contacts both copies of DotD within the asymmetric unit, although they use different surfaces to mediate this interaction. (c) The two folds have a nearly identical topology. Proteins colored as in panel (a). (d) Although these folds are very similar, at least three regions could be used to distinguish between the two proteins in this map. (e) Characteristic density is observed for each protein and supports the assignment of each protein within the map.

On the periplasmic side of the OMC is another small globular fold that we identified as the C-terminal domain of DotH. DotH consists of two β-sheets that are arranged in a β-sandwich fold (Figures 2B and 6A). Our subsequent structural search identified the VirB9 homolog TraO as the protein with the highest degree of structural similarity to DotH (PDB 3JQO, Figure 6B). Indeed, TraO harbors a conserved fold that is also observed in similar proteins such as VirB9 and CagX (Figure 6C). DotH could not have been predicted as a VirB9 homolog based on its primary structure, as very little conservation is observed between the two proteins (Figure 6D). Similar to its counterparts in other species (Chung et al., 2019; Sgro et al., 2018; Rivera-Calzada et al., 2013; Chandran et al., 2009), the C-terminal domain of DotH begins with an α-helix positioned near the center of the map which extends outward from the periplasm (Figure 6E).

Figure 6. — (a) The C-terminal domain of DotH was discovered within the center of the OMC map and consists of a β-sandwich fold. (b) The structure is similar to other T4SS proteins such as the C-termini of TraO, VirB9, and CagX. (c) Though the structures are similar, little sequence similarity (d) is observed throughout the family. (e) DotH is positioned such that the N-terminus (consisting of 272 residues) is positioned between the OMC and PR.

Within the OMC disk we traced three poly-alanine chains that could not be unambiguously identified as any component of the Dot/Icm T4SS (Figures 2B and 7A). The first (chain 1) is a two-lobed polypeptide where ~70 residues form a series of loops (Figure 7B). This unknown protein is positioned atop the OMC making contact with DotC, DotD, DotH, and presumably the outer membrane (Figure 7A). Located on the periphery of the map and extending outward radially, we have modeled a 22-strand β-helix (chain 2) (Figure 7C). Bound to this β-helix is a small fold consisting of six strands (chain 3). It is currently unclear if this domain represents an insertion in the β-helix or a distinct protein (Figure 7D). Based on previous reports it is tempting to speculate that the β-helix structure may correspond to DotG (Ghosal et al., 2019). However, a register could not be identified in this part of the density due to low resolution, and, additionally, tomography studies have suggested the penta-peptide repeats reside in the stalk of the Dot/Icm T4SS (Ghosal et al., 2019).

Figure 7. — (a) Three chains were constructed as polyalanine models, denoted as chain 1–3 and shown in gray. (b) Chain 1 is observed near the outer membrane and consists of loops forming two lobes. (c) Chain 2 consists of a long β-helix that interacts with chain 3. (d) Chain 3 is a small globular fold that is comprised of only β-strands.

To test whether DotG may be localized to the dome region, the radial arms, or both, we isolated and structurally characterized the T4SS in a Lp mutant lacking DotG (∆dotG) (Figure 8A, Figure 8—figure supplements 1, 2 and 3). Although ΔdotG mutant bacteria assemble a Dot/Icm T4SS, they are defective for secretion and replication in host cells (Vogel et al., 1998). Mass spectrometry from this mutant purification confirms DotG is absent (Table 2). The ΔDotG T4SS also lacks DotF (Table 2). Since Western blotting analysis of purified complexes from a ΔdotG mutant bacteria showed wild-type levels of DotF (Kubori et al., 2014), the dotG deletion-insertion allele analyzed here may be polar on expression of the downstream dotF gene. Our structural analysis of ΔDotG T4SS shows that while it contains the OMC disk and the 13 extended arms, the complex lacks both the dome and the PR (Figure 8A and Figure 8—figure supplement 1D). This finding is in agreement with the proposed model for the overall organization of both ∆DotG T4SS and ∆DotF∆DotG T4SS complexes predicted from immunoblot analysis and images of negatively stained T4SS complexes lacking either DotF or DotG (Kubori et al., 2014). All components modeled in the OMC from the wild-type T4SS were also present within the ΔDotG T4SS complexes, supporting the identifications described above (Table 2, Figure 8B). In other T4SSs, the dome region of the complex is comprised of homologous proteins known as VirB10 (X. citri), CagY (H. pylori), or TraF (pKM101). By sequence homology, the C-terminus of DotG is predicted to be structurally similar to these components (Figure 8—figure supplement 4A,C; Chung et al., 2019; Sgro et al., 2018; Rivera-Calzada et al., 2013; Chandran et al., 2009; Ghosal et al., 2017; Nagai and Kubori, 2011; Hu et al., 2019). Thus, we propose that the C-terminus of DotG makes up the dome of the Lp T4SS (Figure 8—figure supplement 4B). In agreement with this, we note that a model of the C-terminus of DotG based on the structure of CagY (generated in Swiss Model) fits into the dome density (Figure 8—figure supplement 4B), though its identity as DotG needs to be confirmed (Waterhouse et al., 2018). The rest of DotG and DotF may contribute to the structural interface between the OMC and the PR and/or form a portion of the structure of the PR.

Figure 8. — (a) The OMC disk of the ΔDotG T4SS was reconstructed from samples that were purified from a strain lacking DotG (Δ*dotG*). (b) All proteins within the asymmetric unit adopt nearly identical orientations in complexes identified from the WT and mutant strain. (Colored as in panel a).

Figure 8—figure supplement 1. — (a) The OMC disk of the ΔDotG T4SS was reconstructed from samples that were purified from a strain lacking DotG (Δ*dotG*). (b) All proteins within the asymmetric unit adopt nearly identical orientations in complexes identified from the WT and mutant strain. (Colored as in panel a).

Table 2. Dot proteins present in isolated complex sample isolated from ΔdotG deletion strain.

		Spectral Counts^†
Identified proteins	Gene Number*	Prep 1	Prep 2	Prep 3
IcmF	Q5ZYB4	28	85		72
DotA	Q5ZS33	20	94		63
IcmX	Q5ZS30	15	88		25
DotH^‡	Q5ZYC2	11	81		25
DotC	Q5ZS44	12	58		17
DotO	Q5ZYB6	16	27		38
Lpg0657	Q5ZXS4	7	43		13
DotL	Q5ZYC6	8	15		32
DotB	Q5ZS43	10	23		13
DotK	Q5ZYC5	6	26		6
DotD	Q5ZS45	3	27		6
IcmW	Q5ZS31	5	9		9
DotI	Q5ZYC3	1	10		4
IcmV	Q5ZS32	2	1		11
DotU	Q5ZYB3	1	5		2
DotM	Q5ZYC7	0	2		6
IcmS	Q5ZYD0	2	2		4

Open in a new tab

*UniProtKB Accession Number.

^†Proteins were identified by searching the MS/MS data against L. pneumophila (UniProt; 2930 entries) using Proteome Discoverer (v2.1, Thermo Scientific). Search parameters included MS1 mass tolerance of 10 ppm and fragment tolerance of 0.1 Da. False discovery rate (FDR) was determined using Percolator and proteins/peptides with a FDR of ≤1% were retained for further analysis. The complete results are shown in Supplementary file 2 in the supplemental material.

^‡Predicted core T4SS components and additional components identified in this structure are in bold.

Our predicted placement of DotF and DotG is consistent with two previous reports (Ghosal et al., 2019; Vincent et al., 2006). Biochemical studies showed that DotG associates closely with DotH and DotC, shown here to form part of the OMC (Figure 2B), and that both DotF and DotG are integral inner membrane proteins that also associate with the outer membrane (Vincent et al., 2006). A cryo-ET analysis of the T4SS in a ΔdotG strain reported missing density from the stalk, plug, and dome compared to subtomogram averages from T4SS complexes in a wild-type strain (Ghosal et al., 2019). Moreover, these cryoET studies showed that the T4SS subtomogram averages in a ΔdotF strain lack density in the periplasmic region compared to complex in a wild-type strain (Ghosal et al., 2019).

The PR has been observed in the recently characterized single particle cryo-EM reconstruction of the H. pylori Cag T4SS and tomography studies of both H. pylori and L. pneumophila T4SSs (Chung et al., 2019; Ghosal et al., 2017; Ghosal et al., 2019; Chetrit et al., 2018; Park et al., 2020; Hu et al., 2019; Chang et al., 2018). The resolution in this region of our Dot/Icm T4SS map was sufficient to model two distinct polyalanine chains within the PR (Figure 9A,B). The backbone trace of one of these chains revealed a structure homologous to the N-terminus of X. citri VirB9 and similar to a polyalanine model of the PR constructed from the H. pylori T4SS (Figure 9C). The other, as of yet unidentified, density within the PR is comprised of a single α-helix followed by an extended loop that spans the entire length of the PR. Although the identity of either protein is currently not clear, prime candidates are either DotG or DotF, two proteins present in our preparations but not confidently localized in our maps (Table 1, Figure 2B). In addition, the entire PR is missing from the ∆DotG T4SS (Table 2, Figure 7A). As was reported previously for the H. pylori Cag T4SS (Chung et al., 2019), while the Lp OMC and PR make physical contact in the lower resolution map with no applied symmetry (Figure 9D), the connections are lost in the refined structures due to the symmetry mismatch.

Figure 9. — (a) The Dot/Icm T4SS is comprised of two features known as the outer membrane cap (OMC) and the periplasmic ring (PR). Within the asymmetric unit of the PR we have modeled two chains (shown in yellow and green). (b) Chain 1 of the PR, shown in yellow, consists of two β-sheets and two α-helices. Chain 2, shown in green, consists of one β-strand and one α-helix. (c) Chain 1 of the Dot/Icm T4SS contains a globular fold that is similar to the N-terminus of VirB9 from *X. citri* and the core fold of the polyalanine model that was modeled in the PR of the Cag T4SS from *H. pylori.* (d) The physical connection between the OMC disk (blue) and PR (green) is shown with atomic models fit into the cryoEM reconstruction with no symmetry applied (gray).

The high-resolution structure of the L. pneumophila Dot/Icm T4SS allows us to compare the structural organization shared between the H. pylori Cag T4SS and the L. pneumophila Dot/Icm T4SS (Figure 10). Both structures display different symmetry within the OMC and PR (Chung et al., 2019); however, the symmetry mismatch itself is conserved, suggesting that this feature is important to the function of secretion systems. However, many questions remain about which T4SS components are most important for translocation efficiency, how substrates are recognized, and how effectors are engaged. To address these remaining questions in the context of the Dot/Icm T4SS, future studies need to characterize the presently unidentified chains and determine the roles and locations of DotF and DotG in this complex. As our high-resolution structure of the OMC revealed unexpected core components (DotK and Lpg0657), additional insights into the stalk and coupling proteins of the Dot/Icm T4SS are also needed. This first high-resolution structure of the Dot/Icm T4SS shows the importance of complex intermolecular interactions between core components to build a large OMC and highlights the conservation of symmetry mismatch in complex T4SSs, suggesting that both structural features are important for the function of these very large transport systems.

Figure 10. — (a) Surface view of atomic models for Hp Cag T4SS (left) and Lp Dot/Icm T4SS (right). OMC, blue; PR, green. For Lp Dot/Icm T4SS, C1 EM density is shown in gray for density not included in atomic models. (b) Secondary structure of Hp Cag T4SS (left) and Lp Dot/Icm T4SS (right). For Lp Dot/Icm T4SS, dome region outline is shown as a dotted line.

Materials and methods

Key resources table.

Reagent type (species) or resource	Designation	Source or reference	Identifiers	Additional information
Strain, strain background (Legionella pneumophila)	Lp02; WT	PMID:23717549
Strain, strain background (Legionella pneumophila)	ΔdotG	This paper		ΔdotG deletion-insertion mutant
Recombinant DNA reagent	pKD3 (plasmid)	Sigma Aldrich	RRID:AddGene_45604	template plasmids for frt-flanked cat cassette
Sequence-based reagent	dotG-F	This paper	PCR primers	aaagcactccacctaagcctacag
Sequence-based reagent	dotG-R	This paper	PCR primers	aaaaattagccaagcccgacctg
Sequence-based reagent	dotG-P0	This paper	PCR primers	aaatcatgcaactcaaggtagaagggttataa gcaaatgtgtgtaggctggagctgcttc
Sequence-based reagent	dotG-P2	This paper	PCR primers	tatccgccatcaaattaaattgttgtaacatcct ggcatatgaatatcctccttagttcc
Commercial assay or kit	ProteoSilver Plus Silver Stain Kit	Sigma Aldrich	PROTSIL2-1KT
Software, algorithm	Leginon	PMID:15890530
Software, algorithm	MotionCor2	PMID:28250466
Software, algorithm	CTFFind4	PMID:26278980
Software, algorithm	cryoSPARC	PMID:28165473
Software, algorithm	RELION	PMID:27685097 PMID:30412051
Software, algorithm	Coot	PMID:20383002
Software, algorithm	UCSF Chimera	PMID:15264254 PMID:29340616
Software, algorithm	PHENIX	PMID:29872004
Software, algorithm	DALI server	PMID:31263867

Open in a new tab

Preparation of strains

L. pneumophila was cultured in ACES (Sigma)-buffered yeast extract broth at pH 6.9 supplemented with 0.1 mg/ml thymidine, 0.4 mg/ml L-cysteine, and 0.135 mg/ml ferric nitrate or on solid medium of this broth supplemented with 15 g/liter agar and 2 g/liter charcoal. The L. pneumophila laboratory strain Lp02, a thymidine auxotroph derived from the clinical isolate Philadelphia-1 (Rao et al., 2013), was utilized as the wild-type strain. The dotG locus of Lp02 was replaced with a cat cassette encoding chloramphenicol resistance by homologous recombination as previously described (Bryan et al., 2013). The wild-type and ΔdotG alleles were amplified using primers dotG-F (5’-aaagcactccacctaagcctacag-3’) and dotG-R (5’-aaaaattagccaagcccgacctg-3’). The cat cassette was amplified from plasmid pKD3 (Datsenko and Wanner, 2000) using primers dotG-P0 (5’ aaatcatgcaactcaaggtagaagggttataagcaaatgtgtgtaggctggagctgcttc-3’) and dotG-P2 (5’-tatccgccatcaaattaaattgttgtaacatcctggcatatgaatatcctccttagttcc-3’). The ΔdotG deletion-insertion mutant was selected and purified on medium supplemented with 5 μg/ml chloramphenicol.

Complex isolation

Complexes were isolated from wild-type L. pneumophila strain Lp02 and the ΔdotG mutant strain as described (Kubori and Nagai, 2019; Kubori et al., 2014). Cells were suspended in 140 mL of buffer containing 150 mM Trizma base pH 8.0, 500 mM NaCl, and EDTA-free Complete protease inhibitor (Roche) at 4°C. The suspension was incubated on the benchtop, with stirring, until it reached ambient temperature. PMSF (final concentration 1 mM), EDTA (final concentration 1 mM), and lysozyme (final concentration 0.1 mg/mL) were added and the suspension was incubated at ambient temperature for an additional 30 min. Bacterial membranes were lysed using detergent and alkaline lysis. Triton X-100 (20% w/v) with AG501-X8 resin (BioRad) was added dropwise, followed by MgSO₄ (final concentration 3 mM), DNaseI (final concentration 5 μg/mL), and EDTA (final concentration 10 mM), and then the pH was adjusted to 10.0 using NaOH. The remaining steps were conducted at 4°C. The cell lysate was subjected to centrifugation at 12,000 x g for 20 min to remove unlysed material. The supernatant was then subjected to ultracentrifugation at 100,000 x g for 30 min to pellet membrane complexes. The membrane complex pellets were resuspended and soaked overnight in a small volume of TET buffer (10 mM Trizma base pH 8.0, 1 mM EDTA, 0.1% Triton X-100). The resuspended sample was then subjected to centrifugation at 14,000 x g for 30 min to pellet debris. The supernatant was subjected to ultra-centrifugation at 100,000 x g for 30 min. The resulting pellet was resuspended in TET and complexes were further separated by Superose 6 10/300 column chromatography in TET buffer with 150 mM NaCl using an AKTA Pure system (GE Life Sciences). The sample collected from the column was used for microscopy and visualized by SDS-PAGE with silver staining (ProteoSilver Plus Silver Stain Kit). Mass spectrometry analysis was performed as described (Anwar et al., 2018).

Cryo-EM data collection and map reconstruction – wild type T4SS

For cryo-EM, 4 μL of the isolated Dot/Icm T4SS sample was applied to a glow discharged ultrathin continuous carbon film on Quantifoil 2/2 200 mesh copper grids (Electron Microscopy Services). The sample was applied to the grid five consecutive times and incubated for ~60 s after each application. The grid was then rinsed in water to remove detergent before vitrification by plunge-freezing in a slurry of liquid ethane using a FEI vitrobot at 4°C and 100% humidity.

The images of the T4SS complexes from wild-type cells were collected on the Thermo Fisher 300 kV Titan Krios with Gatan K2 Summit Direct Electron Detector (DED) camera having a nominal pixel size of 1.64 Å. Micrographs were acquired using Leginon software (Suloway et al., 2005). The total exposure time was 16 s, and frames were recorded every 0.2 s, resulting in a total accumulated dose of 58.1 e^- Å⁻² using a defocus range of −1 to −3 μm.

The video frames were first dose-weighted and aligned using Motioncor2 (Zheng et al., 2017). The contrast transfer function (CTF) values were determined using CTFFind4 (Rohou and Grigorieff, 2015). Image processing was carried out using cryoSPARC and RELION 3.0 (Punjani et al., 2017; Bharat and Scheres, 2016; Zivanov et al., 2018). Using the template picker in cryoSPARC, 771,806 particles were picked from 3,594 micrographs and extracted using a 510 pixel box size (1.64 Å/pixel). The extracted particles were used to generate representative 2D classes in cryoSPARC and approximately 20,800 particles were kept in good classes. These particles were then used for an ab initio model in cryoSPARC, which was then used as the reference for 3D auto-refinement with and without C13 symmetry (lowpass filtered to 40 Å). Finally, a solvent mask and B-factor were applied to improve the overall features and resolution of the 3D maps with and without C13 symmetry, resulting in reconstruction of 3D maps with a global resolution of 4.55 Å and 3.60 Å, respectively.

The C13 refined volume and corresponding particles were then exported to RELION for focused refinements. Estimation of beam-tilt values (CTF-refinement) was applied to the selected particles using RELION. With the CTF-refined particle stack, C13 symmetry-imposed refinement with a soft mask around the core complex was done, resulting in a 5.0 Å resolution 3D map.

For focused refinement of the OMC disk, signal subtraction for each particle containing the OMC disk was used with a soft mask. The subtracted particles were subjected to alignment-free focused 3D classification (three classes). The best 3D class of the OMC (~12,200 particles) was then subjected to a masked 3D refinement with local angular searches using C13 symmetry resulting in a 4.60 Å resolution. Estimation of per-particle defocus values (CTF-refinement) was applied to the selected particles using RELION. With the CTF-refined particle stack, C13 symmetry-imposed refinement with a soft mask around the OMC disk region of the Dot/Icm T4SS core complex was done, resulting in a 4.33 Å resolution 3D map that contained improved features. Post-processing resulted in the final OMC disk map with 3.5 Å resolution.

The same steps were followed for focused refinement of the PR, starting with signal subtraction for each particle containing the PR with a soft mask. The subtracted particles were subjected to alignment-free focused 3D classification (three classes). The best 3D class of the PR (~6850 particles) was selected based on class distribution (particle distribution), estimated resolution, and comparison of the 3D density maps. This class was then subjected to a masked 3D refinement with local angular searches using C18 symmetry resulting in a 7.54 Å resolution. Estimation of per-particle defocus values (CTF-refinement) was applied to the selected particles using RELION. With the CTF-refined particle stack, C18 symmetry-imposed refinement with a soft mask around the PR region of the Dot/Icm T4SS core complex was done, resulting in a 7.40 Å resolution 3D map that contained improved features. Post-processing resulted in the final PR map with 3.7 Å resolution. Map and model building data is summarized in Appendix 1—table 1.

Cryo-EM data collection and map reconstruction – ΔDotG T4SS

For cryo-EM, 4 μL of the isolated ΔDotG T4SS sample was applied to a glow discharged Quantifoil 2/2 200 mesh copper grid with ultrathin (2 nm) continuous carbon film (Electron Microscopy Services). The sample was applied to the grid five consecutive times and incubated for ~60 s after each application. The grid was rinsed in water to remove detergent before vitrification by plunge-freezing in a slurry of liquid ethane using a FEI vitrobot at 22°C and 100% humidity.

The images of the T4SS complexes purified from the ΔdotG cells were collected by personnel at the National Center for CryoEM and Training (NCCAT) on the Thermo Fisher 300 kV Titan Krios with Gatan K2 Summit Direct Electron Detector (DED) camera having a nominal pixel size of 1.07 Å. Micrographs were acquired using Leginon software (Suloway et al., 2005). The total exposure time was 8 s and frames were recorded every 0.2 s, resulting in a total accumulated dose of ~65 e^- Å⁻² using a defocus range of −1.5 to −2.5 μm.

The video frames were first dose-weighted and aligned using Motioncor2 (Zheng et al., 2017). The CTF values were determined using CTFFind4 (Rohou and Grigorieff, 2015). Image processing was carried out using cryoSPARC and RELION 3.0 (Punjani et al., 2017; Bharat and Scheres, 2016; Zivanov et al., 2018). 120,367 particles were picked manually using Relion from 6990 micrographs and extracted using a 640 pixel box size (1.07 Å/pixel). The particles were imported into cryoSPARC, and the remaining processing steps were performed in cryoSPARC. The extracted particles were used to generate representative 2D classes and 9619 particles were kept in good classes. These particles were used to generate two 3D ab initio models with C13 symmetry, the better of which contained 6342 particles. Homogeneous refinement of this model, also with C13 symmetry, resulted in a map with 4.2 Å resolution.

Model building and refinement

A model was constructed from the OMC disk by first tracing all chains within the asymmetric unit using Coot (Emsley et al., 2010). We identified two folds that were similar to the crystal structure of DotD and thus docked the corresponding crystal structure (PDB 3ADY) into the map using UCSF Chimera (Nakano et al., 2010). All other chains were then iteratively built de novo in Coot and refined in PHENIX (Afonine et al., 2018). During subsequent rounds of model building and refinement it was noted that a second fold which was similar to DotK was present in the EM map which could not be identified as any of the known core components. The structure of DotK was then subjected to a protein fold analysis using the DALI server which returned Lpg0657 as a potential candidate (Holm, 2019). This crystal structure of Lpg0657 (PDB 3LDT) was then docked into the map using UCSF Chimera and the entire asymmetric unit was refined. The asymmetric unit was then duplicated in UCSF Chimera and each asymmetric unit docked into the map to generate a model of the entire OMC (Pettersen et al., 2004; Rodríguez-Guerra Pedregal and Maréchal, 2018). This structure was then refined in PHENIX with secondary structure and Ramachandran restraints applied (Afonine et al., 2018). During iterative rounds of refinement the nonbonded weighting parameter within PHENIX was optimized. A polyalanine model of the PR was constructed de novo in Coot and was refined using a similar protocol to that which was outlined above (Emsley et al., 2010).

To generate a model of the entire core complex, maps from the focused refinement of the OMC disk and PR were aligned in UCSF Chimera using the asymmetric reconstruction as a guide. The maps were then combined in PHENIX using phenix.combine_focus_maps with the models of the OMC disk and PR provided as additional templates (Afonine et al., 2018). The entire complex was then subjected to a round of refinement in PHENIX with secondary structure and Ramachandran restraints applied. Figure 2—figure supplement 1 shows the Fourier shell correlations (FSCs) of the half maps against the refined model agree with each other, suggesting that the models are not over-refined.

To model the OMC reconstructed from the ΔdotG strain, the OMC disk from the wild type strain was docked into the map using UCSF Chimera (Pettersen et al., 2004). The model was then refined in PHENIX following a similar protocol to that which was outlined above (Afonine et al., 2018). Figures were made in part using ChimeraX (Rodríguez-Guerra Pedregal and Maréchal, 2018).

Acknowledgements

The work presented here was supported by NIH R01AI118932 (MDO), F32 AI150027-01 (CLD), NIH 2T32DK007673 (MJS), S10OD020011 and the University of Michigan Department of Microbiology and Immunology (Swanson). Some of this work was performed at the National Center for CryoEM Access and Training (NCCAT) and the Simons Electron Microscopy Center located at the New York Structural Biology Center, supported by the NIH Common Fund Transformative High Resolution Cryo-Electron Microscopy program (U24 GM129539,) and by grants from the Simons Foundation (SF349247) and NY State. A portion of the molecular graphics and analyses was performed with UCSF Chimera, developed by the Resource for Biocomputing, Visualization, and Informatics at UC-San Francisco, with support from NIH P41-GM103311. Mass spectrometry experiments were performed by the University of Michigan Proteomics Resource Facility. The authors acknowledge Young-In (Eva) Kwon for assistance with figures. We thank the Cianfrocco, Cover, Lacy, and Ohi labs for helpful discussions. We acknowledge the use of the U-M LSI cryo-EM facility, managed by M Su, A Bondy, and L Koepping, and U-M LSI IT support. We thank U-M BSI and LSI for significant support of the cryo-EM facility.

Appendix 1

Appendix 1—table 1. Map reconstruction and model refinement.

Cryo-EM data collection and processing
EMDB accession codes	Dot/Icm T4SS OMC WT EMD-22068	Dot/Icm T4SS PR WT EMD-22069	Dot/Icm T4SS EMD-22070	Dot/Icm T4SS OMC ΔDotG EMD-22071
Data Collection and Processing
Magnification	18,000	18,000		29,000
Voltage (kV)	300	300		300
Total Electron Dose (e-/Å2)	58.1	58.1		~65.0
Defocus Range (µM)	−1 ~ −3	−1 ~ −3		−1.5 ~ −2.5
Pixel Size (Å)	1.64	1.64		1.07
Processing Software	cryoSPARC/Relion	cryoSPARC /Relion		cryoSPARC/Relion
Symmetry	C13	C18		C13
Initial Particles (number)	771,806	771,806		120,367
Final Particles (number)	12,200	6,850		6,342
Map Sharpening B Factor	−40.63	−52.51		−55.3
Map Resolution (Å)	3.5	3.7		4.2
FSC Threshold	0.143	0.143		0.143
Model Refinement and Validation
Refinement
Initial Model Used	3ADY, 3LDT	N/A	N/A	N/A
Model Resolution
FSC (0.5)	3.4	3.9	3.6	7.3
FSC (0.143)	3.2	3.6	3.2	4.2
Model Composition (Residues)	15,548	3,168	18,716	15,548
DotC	58–161, 173–268	-	58–161, 173–268	58–161, 173–268
DotD₁	25–159	-	25-159	25-159
DotD₂	2–161	-	2–161	2–161
DotH	273–361	-	273–361	273–361
DotK	41–180	-	41–180	41–180
Lpg0657	99–234	-	99–234	99–234
Unk OMC Chain 1	1-70	-	1-70	1-70
Unk OMC Chain 2	1–127	-	1–127	1–127
Unk OMC Chain 3	1-52	-	1-52	1-52
Unknown PR	-	1–32, 1–144	1–32, 1–144	-

Bond RMSD
Bond Length (Å)	0.014	0.007	0.01	0.016
Bond Angle (°)	1.868	1.06	1.27	1.723
Validation
Molprobity Score	2.41	1.17	2.70	2.44
Clashscore	6.9	0.47	6.94	21.63
Ramachandran (%)
Favored	91.5	91.5	92	87.7
Allowed	8.5	8.5	8	12.3
Outliers	0.0	0.0	0.0	0.0
B Factor	94.6	60.7	152.1	341.9
PDB Accession Codes	6 × 62	6 × 64	6 × 65	6 × 66

Open in a new tab

Funding Statement

The funders had no role in study design, data collection and interpretation, or the decision to submit the work for publication.

Contributor Information

Michele Swanson, Email: mswanson@umich.edu.

D Borden Lacy, Email: borden.lacy@vanderbilt.edu.

Melanie D Ohi, Email: mohi@umich.edu.

Andrew P Carter, MRC Laboratory of Molecular Biology, United Kingdom.

John Kuriyan, University of California, Berkeley, United States.

Funding Information

This paper was supported by the following grants:

National Institute of Allergy and Infectious Diseases F32 AI150027-01 to Clarissa L Durie.
National Institute of General Medical Sciences S10OD020011 to Melanie D Ohi.
National Institute of Allergy and Infectious Diseases 2T32DK007673 to Michele Swanson.
National Institute of Allergy and Infectious Diseases R01AI118932 to Melanie D Ohi.

Additional information

Competing interests

No competing interests declared.

Author contributions

Conceptualization, Resources, Formal analysis, Supervision, Funding acquisition, Validation, Investigation, Visualization, Methodology, Writing - original draft, Project administration, Writing - review and editing.

Resources, Formal analysis, Supervision, Validation, Investigation, Visualization, Methodology, Writing - original draft, Project administration, Writing - review and editing.

Data curation, Formal analysis, Validation, Investigation, Visualization, Methodology, Writing - original draft, Writing - review and editing.

Resources, Data curation, Formal analysis, Validation, Investigation, Methodology, Writing - review and editing.

Conceptualization, Formal analysis, Validation, Investigation, Visualization, Methodology, Writing - original draft, Writing - review and editing.

Resources, Project administration.

Resources, Supervision, Methodology, Project administration, Writing - review and editing.

Resources, Formal analysis, Supervision, Validation, Investigation, Visualization, Methodology, Project administration, Writing - review and editing.

Conceptualization, Resources, Formal analysis, Supervision, Funding acquisition, Investigation, Visualization, Methodology, Writing - original draft, Project administration, Writing - review and editing.

Additional files

Supplementary file 1. Proteins that copurify with Dot T4SS.

a UniProtKB Accession Number b Proteins were identified by searching the MS/MS data against L. pneumophila (UniProt; 2930 entries) using Proteome Discoverer (v2.1, Thermo Scientific). Search parameters included MS1 mass tolerance of 10 ppm and fragment tolerance of 0.1 Da. False discovery rate (FDR) was determined using Percolator and proteins/peptides with a FDR of ≤1% were retained for further analysis. c Dot/Icm T4SS components are in bold.

elife-59530-supp1.xlsx^{(70.6KB, xlsx)}

Supplementary file 2. Proteins that copurify with ΔDotG T4SS.

^aUniProtKB Accession Number ^bProteins were identified by searching the MS/MS data against L. pneumophila (UniProt; 2930 entries) using Proteome Discoverer (v2.1, Thermo Scientific). Search parameters included MS1 mass tolerance of 10 ppm and fragment tolerance of 0.1 Da. False discovery rate (FDR) was determined using Percolator and proteins/peptides with a FDR of ≤1% were retained for further analysis.^cDot/Icm T4SS components are in bold.

elife-59530-supp2.xlsx^{(62.5KB, xlsx)}

Transparent reporting form

elife-59530-transrepform.docx^{(247.4KB, docx)}

Data availability

All cryo-EM data included in this manuscript are available through the Electron Microscopy Data Bank (EMD-22068, EMD-22069, EMD-22070 and EMD-22071). All models that were constructed from these data are available via the Protein Data Bank (PDB 6x62, 6x64, 6x65, and 6x66).

The following datasets were generated:

Durie CL, Sheedlo MJ, Chung JM, Byrne BG, Su M, Knight T, Swanson M, Lacy DB, Ohi MD. 2020. Atomic model. RCSB Protein Data Bank. 6x62

Durie CL, Sheedlo MJ, Chung JM, Byrne BG, Su M, Knight T, Swanson M, Lacy DB, Ohi MD. 2020. Atomic model. RCSB Protein Data Bank. 6x64

Durie CL, Sheedlo MJ, Chung JM, Byrne BG, Su M, Knight T, Swanson M, Lacy DB, Ohi MD. 2020. Atomic model. RCSB Protein Data Bank. 6x65

Durie CL, Sheedlo MJ, Chung JM, Byrne BG, Su M, Knight T, Swanson M, Lacy DB, Ohi MD. 2020. Atomic model. RCSB Protein Data Bank. 6x66

Durie CL, Sheedlo MJ, Chung JM, Byrne BG, Su M, Knight T, Swanson M, Lacy DB, Ohi MD. 2020. Dot/Icm T4SS OMC WT. Electron Microscopy Data Bank. EMD-22068

Durie CL, Sheedlo MJ, Chung JM, Byrne BG, Su M, Knight T, Swanson M, Lacy DB, Ohi MD. 2020. Dot/Icm T4SS PR WT. Electron Microscopy Data Bank. EMD-22069

Durie CL, Sheedlo MJ, Chung JM, Byrne BG, Su M, Knight T, Swanson M, Lacy DB, Ohi MD. 2020. Dot/Icm T4SS. Electron Microscopy Data Bank. EMD-22070

Durie CL, Sheedlo MJ, Chung JM, Byrne BG, Su M, Knight T, Swanson M, Lacy DB, Ohi MD. 2020. Dot/Icm T4SS OMC ΔDotG. Electron Microscopy Data Bank. EMD-22071

References

Afonine PV, Poon BK, Read RJ, Sobolev OV, Terwilliger TC, Urzhumtsev A, Adams PD. Real-space refinement in PHENIX for cryo-EM and crystallography. Acta Crystallographica. Section D, Structural Biology. 2018;74:531–544. doi: 10.1107/S2059798318006551. [DOI] [PMC free article] [PubMed] [Google Scholar]
Anwar T, Arellano-Garcia C, Ropa J, Chen YC, Kim HS, Yoon E, Grigsby S, Basrur V, Nesvizhskii AI, Muntean A, Gonzalez ME, Kidwell KM, Nikolovska-Coleska Z, Kleer CG. p38-mediated phosphorylation at T367 induces EZH2 cytoplasmic localization to promote breast Cancer metastasis. Nature Communications. 2018;9:2801. doi: 10.1038/s41467-018-05078-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
Bharat TA, Scheres SH. Resolving macromolecular structures from electron cryo-tomography data using subtomogram averaging in RELION. Nature Protocols. 2016;11:2054–2065. doi: 10.1038/nprot.2016.124. [DOI] [PMC free article] [PubMed] [Google Scholar]
Bryan A, Abbott ZD, Swanson MS. Constructing unmarked gene deletions in Legionella pneumophila. Methods in Molecular Biology. 2013;954:197–212. doi: 10.1007/978-1-62703-161-5_10. [DOI] [PubMed] [Google Scholar]
Cascales E, Christie PJ. The versatile bacterial type IV secretion systems. Nature Reviews Microbiology. 2003;1:137–149. doi: 10.1038/nrmicro753. [DOI] [PMC free article] [PubMed] [Google Scholar]
Chandran V, Fronzes R, Duquerroy S, Cronin N, Navaza J, Waksman G. Structure of the outer membrane complex of a type IV secretion system. Nature. 2009;462:1011–1015. doi: 10.1038/nature08588. [DOI] [PMC free article] [PubMed] [Google Scholar]
Chang YW, Shaffer CL, Rettberg LA, Ghosal D, Jensen GJ. In Vivo Structures of the Helicobacter pylori cag Type IV Secretion System. Cell Reports. 2018;23:673–681. doi: 10.1016/j.celrep.2018.03.085. [DOI] [PMC free article] [PubMed] [Google Scholar]
Chetrit D, Hu B, Christie PJ, Roy CR, Liu J. A unique cytoplasmic ATPase complex defines the Legionella pneumophila type IV secretion channel. Nature Microbiology. 2018;3:678–686. doi: 10.1038/s41564-018-0165-z. [DOI] [PMC free article] [PubMed] [Google Scholar]
Christie PJ, Whitaker N, González-Rivera C. Mechanism and structure of the bacterial type IV secretion systems. Biochimica Et Biophysica Acta (BBA) - Molecular Cell Research. 2014;1843:1578–1591. doi: 10.1016/j.bbamcr.2013.12.019. [DOI] [PMC free article] [PubMed] [Google Scholar]
Chung JM, Sheedlo MJ, Campbell AM, Sawhney N, Frick-Cheng AE, Lacy DB, Cover TL, Ohi MD. Structure of the Helicobacter pylori cag type IV secretion system. eLife. 2019;8:e47644. doi: 10.7554/eLife.47644. [DOI] [PMC free article] [PubMed] [Google Scholar]
Datsenko KA, Wanner BL. One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products. PNAS. 2000;97:6640–6645. doi: 10.1073/pnas.120163297. [DOI] [PMC free article] [PubMed] [Google Scholar]
Emsley P, Lohkamp B, Scott WG, Cowtan K. Features and development of coot. Acta Crystallographica. Section D, Biological Crystallography. 2010;66:486–501. doi: 10.1107/S0907444910007493. [DOI] [PMC free article] [PubMed] [Google Scholar]
Fronzes R, Christie PJ, Waksman G. The structural biology of type IV secretion systems. Nature Reviews Microbiology. 2009;7:703–714. doi: 10.1038/nrmicro2218. [DOI] [PMC free article] [PubMed] [Google Scholar]
Ghosal D, Chang YW, Jeong KC, Vogel JP, Jensen GJ. In situ structure of the Legionella dot/Icm type IV secretion system by electron cryotomography. EMBO Reports. 2017;18:726–732. doi: 10.15252/embr.201643598. [DOI] [PMC free article] [PubMed] [Google Scholar]
Ghosal D, Jeong KC, Chang YW, Gyore J, Teng L, Gardner A, Vogel JP, Jensen GJ. Molecular architecture, polar targeting and biogenesis of the Legionella dot/Icm T4SS. Nature Microbiology. 2019;4:1173–1182. doi: 10.1038/s41564-019-0427-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
Goodwin IP, Kumova OK, Ninio S. A conserved OmpA-like protein in Legionella pneumophila required for efficient intracellular replication. FEMS Microbiology Letters. 2016;363:fnw173. doi: 10.1093/femsle/fnw173. [DOI] [PMC free article] [PubMed] [Google Scholar]
Grohmann E, Christie PJ, Waksman G, Backert S. Type IV secretion in Gram-negative and Gram-positive Bacteria. Molecular Microbiology. 2018;107:455–471. doi: 10.1111/mmi.13896. [DOI] [PMC free article] [PubMed] [Google Scholar]
Holm L. Benchmarking fold detection by DaliLite v.5. Bioinformatics. 2019;35:5326–5327. doi: 10.1093/bioinformatics/btz536. [DOI] [PubMed] [Google Scholar]
Hu B, Khara P, Song L, Lin AS, Frick-Cheng AE, Harvey ML, Cover TL, Christie PJ. In situ Molecular Architecture of the Helicobacter pylori Cag Type IV Secretion System. mBio. 2019;10:e00849-19. doi: 10.1128/mBio.00849-19. [DOI] [PMC free article] [PubMed] [Google Scholar]
Kubori T, Koike M, Bui XT, Higaki S, Aizawa S, Nagai H. Native structure of a type IV secretion system core complex essential for Legionella pathogenesis. PNAS. 2014;111:11804–11809. doi: 10.1073/pnas.1404506111. [DOI] [PMC free article] [PubMed] [Google Scholar]
Kubori T, Nagai H. Isolation of the dot/Icm type IV secretion system core complex from Legionella pneumophila. Methods in Molecular Biology. 2019;1921:241–247. doi: 10.1007/978-1-4939-9048-1_15. [DOI] [PubMed] [Google Scholar]
Lin X, Ye F, Lin S, Yang F, Chen Z, Cao Y, Chen Z, Gu J, Lu G. Crystal structure of PA0833 periplasmic domain from Pseudomonas aeruginosa reveals an unexpected enlarged peptidoglycan binding pocket. Biochemical and Biophysical Research Communications. 2019;511:875–881. doi: 10.1016/j.bbrc.2019.02.104. [DOI] [PubMed] [Google Scholar]
Low HH, Gubellini F, Rivera-Calzada A, Braun N, Connery S, Dujeancourt A, Lu F, Redzej A, Fronzes R, Orlova EV, Waksman G. Structure of a type IV secretion system. Nature. 2014;508:550–553. doi: 10.1038/nature13081. [DOI] [PMC free article] [PubMed] [Google Scholar]
Molofsky AB, Swanson MS. Differentiate to thrive: lessons from the Legionella pneumophila life cycle. Molecular Microbiology. 2004;53:29–40. doi: 10.1111/j.1365-2958.2004.04129.x. [DOI] [PubMed] [Google Scholar]
Nagai H, Kubori T. Type IVB secretion systems of Legionella and other Gram-Negative Bacteria. Frontiers in Microbiology. 2011;2:136. doi: 10.3389/fmicb.2011.00136. [DOI] [PMC free article] [PubMed] [Google Scholar]
Nakano N, Kubori T, Kinoshita M, Imada K, Nagai H. Crystal structure of Legionella DotD: insights into the relationship between type IVB and type II/III secretion systems. PLOS Pathogens. 2010;6:e1001129. doi: 10.1371/journal.ppat.1001129. [DOI] [PMC free article] [PubMed] [Google Scholar]
Park D, Chetrit D, Hu B, Roy CR, Liu J. Analysis of dot/Icm type IVB secretion system subassemblies by cryoelectron tomography reveals conformational changes induced by DotB binding. mBio. 2020;11:e03328-19. doi: 10.1128/mBio.03328-19. [DOI] [PMC free article] [PubMed] [Google Scholar]
Pettersen EF, Goddard TD, Huang CC, Couch GS, Greenblatt DM, Meng EC, Ferrin TE. UCSF chimera--a visualization system for exploratory research and analysis. Journal of Computational Chemistry. 2004;25:1605–1612. doi: 10.1002/jcc.20084. [DOI] [PubMed] [Google Scholar]
Punjani A, Rubinstein JL, Fleet DJ, Brubaker MA. cryoSPARC: algorithms for rapid unsupervised cryo-EM structure determination. Nature Methods. 2017;14:290–296. doi: 10.1038/nmeth.4169. [DOI] [PubMed] [Google Scholar]
Purcell M, Shuman HA. The Legionella pneumophila icmGCDJBF genes are required for killing of human macrophages. Infection and Immunity. 1998;66:2245–2255. doi: 10.1128/IAI.66.5.2245-2255.1998. [DOI] [PMC free article] [PubMed] [Google Scholar]
Rao C, Benhabib H, Ensminger AW. Phylogenetic reconstruction of the Legionella pneumophila Philadelphia-1 laboratory strains through comparative genomics. PLOS ONE. 2013;8:e64129. doi: 10.1371/journal.pone.0064129. [DOI] [PMC free article] [PubMed] [Google Scholar]
Rivera-Calzada A, Fronzes R, Savva CG, Chandran V, Lian PW, Laeremans T, Pardon E, Steyaert J, Remaut H, Waksman G, Orlova EV. Structure of a bacterial type IV secretion core complex at subnanometre resolution. The EMBO Journal. 2013;32:1195–1204. doi: 10.1038/emboj.2013.58. [DOI] [PMC free article] [PubMed] [Google Scholar]
Rodríguez-Guerra Pedregal J, Maréchal JD. PyChimera: use UCSF chimera modules in any Python 2.7 project. Bioinformatics. 2018;34:1784–1785. doi: 10.1093/bioinformatics/bty021. [DOI] [PubMed] [Google Scholar]
Rohou A, Grigorieff N. CTFFIND4: fast and accurate defocus estimation from electron micrographs. Journal of Structural Biology. 2015;192:216–221. doi: 10.1016/j.jsb.2015.08.008. [DOI] [PMC free article] [PubMed] [Google Scholar]
Schroeder GN. The toolbox for uncovering the functions of Legionella Dot/Icm Type IVb Secretion System Effectors: Current State and Future Directions. Frontiers in Cellular and Infection Microbiology. 2017;7:528. doi: 10.3389/fcimb.2017.00528. [DOI] [PMC free article] [PubMed] [Google Scholar]
Segal G, Purcell M, Shuman HA. Host cell killing and bacterial conjugation require overlapping sets of genes within a 22-kb region of the Legionella pneumophila genome. PNAS. 1998;95:1669–1674. doi: 10.1073/pnas.95.4.1669. [DOI] [PMC free article] [PubMed] [Google Scholar]
Segal G, Shuman HA. Legionella pneumophila utilizes the same genes to multiply within Acanthamoeba castellanii and human macrophages. Infection and Immunity. 1999;67:2117–2124. doi: 10.1128/IAI.67.5.2117-2124.1999. [DOI] [PMC free article] [PubMed] [Google Scholar]
Sgro GG, Costa TRD, Cenens W, Souza DP, Cassago A, Coutinho de Oliveira L, Salinas RK, Portugal RV, Farah CS, Waksman G. Cryo-EM structure of the bacteria-killing type IV secretion system core complex from Xanthomonas citri. Nature Microbiology. 2018;3:1429–1440. doi: 10.1038/s41564-018-0262-z. [DOI] [PMC free article] [PubMed] [Google Scholar]
Suloway C, Pulokas J, Fellmann D, Cheng A, Guerra F, Quispe J, Stagg S, Potter CS, Carragher B. Automated molecular microscopy: the new leginon system. Journal of Structural Biology. 2005;151:41–60. doi: 10.1016/j.jsb.2005.03.010. [DOI] [PubMed] [Google Scholar]
Swanson MS, Hammer BK. Legionella pneumophila pathogesesis: a fateful journey from amoebae to macrophages. Annual Review of Microbiology. 2000;54:567–613. doi: 10.1146/annurev.micro.54.1.567. [DOI] [PubMed] [Google Scholar]
Vincent CD, Friedman JR, Jeong KC, Buford EC, Miller JL, Vogel JP. Identification of the core transmembrane complex of the Legionella dot/Icm type IV secretion system. Molecular Microbiology. 2006;62:1278–1291. doi: 10.1111/j.1365-2958.2006.05446.x. [DOI] [PubMed] [Google Scholar]
Vogel JP, Andrews HL, Wong SK, Isberg RR. Conjugative transfer by the virulence system of Legionella pneumophila. Science. 1998;279:873–876. doi: 10.1126/science.279.5352.873. [DOI] [PubMed] [Google Scholar]
Waksman G. From conjugation to T4S systems in Gram-negative Bacteria: a mechanistic biology perspective. EMBO Reports. 2019;20:e47012. doi: 10.15252/embr.201847012. [DOI] [PMC free article] [PubMed] [Google Scholar]
Waterhouse A, Bertoni M, Bienert S, Studer G, Tauriello G, Gumienny R, Heer FT, de Beer TAP, Rempfer C, Bordoli L, Lepore R, Schwede T. SWISS-MODEL: homology modelling of protein structures and complexes. Nucleic Acids Research. 2018;46:W296–W303. doi: 10.1093/nar/gky427. [DOI] [PMC free article] [PubMed] [Google Scholar]
Zheng SQ, Palovcak E, Armache JP, Verba KA, Cheng Y, Agard DA. MotionCor2: anisotropic correction of beam-induced motion for improved cryo-electron microscopy. Nature Methods. 2017;14:331–332. doi: 10.1038/nmeth.4193. [DOI] [PMC free article] [PubMed] [Google Scholar]
Zivanov J, Nakane T, Forsberg BO, Kimanius D, Hagen WJ, Lindahl E, Scheres SH. New tools for automated high-resolution cryo-EM structure determination in RELION-3. eLife. 2018;7:e42166. doi: 10.7554/eLife.42166. [DOI] [PMC free article] [PubMed] [Google Scholar]

eLife. doi: 10.7554/eLife.59530.sa1

Decision letter

Editor: Andrew P Carter¹

Reviewed by: Peter Christie²

In the interests of transparency, eLife publishes the most substantive revision requests and the accompanying author responses.

Acceptance summary:

Type IV Secretion Systems (T4SS) are multi-component complexes used by bacteria to deliver effector proteins into eukaryotic cells during infection. This manuscript describes a high resolution cryo-EM structure of the T4SS from Legionella pneumophila, the causative agent of Legionnaires' Disease. This is a major advance for the T4SS field as the authors are able to definitively assign Dot proteins that make up the complex as well as their structures and details of their interactions at near atomic resolution.

Decision letter after peer review:

Thank you for submitting your article "Structural analysis of the Legionella pneumophila Dot/Icm Type IV Secretion System" for consideration by eLife. Your article has been reviewed by three peer reviewers, and the evaluation has been overseen by a Reviewing Editor and John Kuriyan as the Senior Editor. The following individual involved in review of your submission has agreed to reveal their identity: Peter Christie (Reviewer #3).

The reviewers have discussed the reviews with one another and the Reviewing Editor has drafted this decision to help you prepare a revised submission.

As the editors have judged that your manuscript is of interest, but as described below that additional experiments are required before it is published, we would like to draw your attention to changes in our revision policy that we have made in response to COVID-19 (https://elifesciences.org/articles/57162). First, because many researchers have temporarily lost access to the labs, we will give authors as much time as they need to submit revised manuscripts. We are also offering, if you choose, to post the manuscript to bioRxiv (if it is not already there) along with this decision letter and a formal designation that the manuscript is "in revision at eLife". Please let us know if you would like to pursue this option. (If your work is more suitable for medRxiv, you will need to post the preprint yourself, as the mechanisms for us to do so are still in development.)

Summary:

This manuscript describes a high-resolution structure of the outer portion of the Dot/Icm Type IV secretion system (T4SS) elaborated by Legionella pneumophila. This portion of the T4SS is termed the core complex, and here the authors have solved the structure of the core complex by single-particle cryoelectron microscopy. This is a major advance for the T4SS field insofar as the authors were able to definitively assign Dot proteins that make up the complex as well as their structures and details of their interactions at near atomic resolution. The findings confirm a number of previous predictions derived from biochemical or lower resolution Cryoelectron tomography studies, and also identify new components with unexpected stoichiometries. Important advances are also made in defining the structures and symmetry mismatch of two sub-elements, here designated as the outer membrane cap (OMC) and periplasmic ring (PR). Overall, the findings allow for detailed comparisons between other large T4SSs such as the Helicobacter pylori Cag T4SS, which the authors solved last year, and other T4SSs, e.g., the pKM101 and Xanthomonas VirB systems, whose OMCs are less complex.

Essential revisions:

1) The title somewhat overstates the scope of the structural analysis presented. The title would be more informative/accurate to the reader if it clarified that the structural analysis was specific to the core complex rather than implicating the T4BSS as a whole.

2) Map and model quality analysis is absent. Please include FSC plots of maps versus models. Please include real-space correlation coefficient (CC) between map and model.

3) Results and Discussion, first paragraph. Is there any particular reason why the gel of purified sample is not shown and analysed at least in supplement, especially as Kubori and Nagai, 2019, is from a different group – it would complement the study. In Kubori and Nagai, 2019, the sample was gel filtrated on a Superose6. Is the complex used for this study also gel filtrated etc? And can you see the loss of DotG in the Δ KO strain on the gel?

eLife. 2020 Sep 2;9:e59530. doi: 10.7554/eLife.59530.sa2

Author response

Essential revisions:

1) The title somewhat overstates the scope of the structural analysis presented. The title would be more informative/accurate to the reader if it clarified that the structural analysis was specific to the core complex rather than implicating the T4BSS as a whole.

The title has been revised to indicate that this study describes the core complex.

2) Map and model quality analysis is absent. Please include FSC plots of maps versus models. Please include real-space correlation coefficient (CC) between map and model.

The FSC plots of maps versus models are now included as Figure 2—figure supplement 1 (for WT) and Figure 8—figure supplement 2 (for mutant). As requested, we have included the real-space correlation coefficient (CC) as Figure 2—figure supplement 2 (for WT) and Figure 8—figure supplement 3 (for mutant).

3) Results and Discussion, first paragraph. Is there any particular reason why the gel of purified sample is not shown and analysed at least in supplement, especially as Kubori and Nagai, 2019, is from a different group – it would complement the study. In Kubori and Nagai, 2019, the sample was gel filtrated on a Superose6. Is the complex used for this study also gel filtrated etc? And can you see the loss of DotG in the δ KO strain on the gel?

The gels have been added to Figure 8—figure supplement 1. We observe DotG in the WT gel and not the gel from the mutant strain. The mutant complex was also purified using gel filtration on a Superose6. This and additional details about the strain used for this purification and complex isolation have been added to the Materials and methods under the subheadings “Preparation of Strains” and “Complex Isolation”.

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Data Citations

Durie CL, Sheedlo MJ, Chung JM, Byrne BG, Su M, Knight T, Swanson M, Lacy DB, Ohi MD. 2020. Atomic model. RCSB Protein Data Bank. 6x62 [DOI] [PMC free article] [PubMed]
Durie CL, Sheedlo MJ, Chung JM, Byrne BG, Su M, Knight T, Swanson M, Lacy DB, Ohi MD. 2020. Atomic model. RCSB Protein Data Bank. 6x64 [DOI] [PMC free article] [PubMed]
Durie CL, Sheedlo MJ, Chung JM, Byrne BG, Su M, Knight T, Swanson M, Lacy DB, Ohi MD. 2020. Atomic model. RCSB Protein Data Bank. 6x65 [DOI] [PMC free article] [PubMed]
Durie CL, Sheedlo MJ, Chung JM, Byrne BG, Su M, Knight T, Swanson M, Lacy DB, Ohi MD. 2020. Atomic model. RCSB Protein Data Bank. 6x66 [DOI] [PMC free article] [PubMed]
Durie CL, Sheedlo MJ, Chung JM, Byrne BG, Su M, Knight T, Swanson M, Lacy DB, Ohi MD. 2020. Dot/Icm T4SS OMC WT. Electron Microscopy Data Bank. EMD-22068
Durie CL, Sheedlo MJ, Chung JM, Byrne BG, Su M, Knight T, Swanson M, Lacy DB, Ohi MD. 2020. Dot/Icm T4SS PR WT. Electron Microscopy Data Bank. EMD-22069
Durie CL, Sheedlo MJ, Chung JM, Byrne BG, Su M, Knight T, Swanson M, Lacy DB, Ohi MD. 2020. Dot/Icm T4SS. Electron Microscopy Data Bank. EMD-22070
Durie CL, Sheedlo MJ, Chung JM, Byrne BG, Su M, Knight T, Swanson M, Lacy DB, Ohi MD. 2020. Dot/Icm T4SS OMC ΔDotG. Electron Microscopy Data Bank. EMD-22071

Supplementary Materials

Supplementary file 1. Proteins that copurify with Dot T4SS.

elife-59530-supp1.xlsx^{(70.6KB, xlsx)}

Supplementary file 2. Proteins that copurify with ΔDotG T4SS.

elife-59530-supp2.xlsx^{(62.5KB, xlsx)}

Transparent reporting form

elife-59530-transrepform.docx^{(247.4KB, docx)}

Data Availability Statement