Table 1.
Primer | Sequence (5′–3′) | Nucleotide position | Amplicon size (bp) | Accession number | References | |
---|---|---|---|---|---|---|
ZIKV-forward | AGCAACATGGCGGAGGTAAG | 1128–1147 | 145 | FSS13025 | This study; [34]a | |
ZIKV-reverse | CTGTCCACTAACGTTCTTTTGCAGA | 1249–1273 | ||||
DENV2-forward | TCCCTTCCAAATCGCAGCAACAATG | 10,517–10,541 | 168 | NC_001474.2 | This study; [35]b | |
DENV2-reverse | CGTTCTGTGCCTGGAATGATG | 10,665–10,685 | ||||
wAlbB-forward | CCTTACCTCCTGCACAACAA | 213,522–213,541 | 110 | CP031221.1 | [36] | |
wAlbB-reverse | GGATTGTCCAGTGGCCTTA | 213,394–213,412 | ||||
WNV-forward | TTGTGTTGGCTCTCTTGGCGTTCTT | 233–257 | 408 | AF196835 | [38] | |
WNV-reverse | CAGCCGACAGCACTGGACATTCATA | 640–616 | ||||
JEV-forward | GGCAGAAAGCAAAACAAAAGA | 390–410 | 367 | AF080251 | [39] | |
JEV-reverse | CGGATCTCCTGCTTCGCTTGG | 736–756 | ||||
YFV-forward | CACGGCATGGTTCCTTCCA | 5656–5674 | 71 | MN708497 | [37] | |
YFV-reverse | ACTCTTTCCAGCCTTACGCAAA | 5707–5728 | ||||
CHIKV-forward | TACAGGGCTCATACCGCATC | 10,357–10,376 | 154 | NC_004162 | [40] | |
CHIKV-reverse | AAAGGTGTCCAGGCTGAAGA | 10,492–10,511 |
aZIKV primers were modified and optimized for qRT-PCR
bDENV2 primers were modified and optimized for qRT-PCR
Notes: The cross-reactivity panel primer sequences were included to confirm viral RNA obtained from BEI Resources. Four viruses were included in this study: West Nile virus (WNV), Japanese encephalitis virus (JEV), yellow fever virus (YFV) and chikungunya virus (CHIKV). Primer sequence, nucleotide position and amplicon size are listed