Skip to main content
. Author manuscript; available in PMC: 2020 Sep 25.
Published in final edited form as: J Pediatr Hematol Oncol. 2011 Jul;33(5):360–368. doi: 10.1097/MPH.0b013e3182002f9f

FIGURE 2.

FIGURE 2.

The ASPL-TFE3 type 1 fusion transcript is expressed in ASPS-1 cells. ASPL-TFE3 fusion transcripts were detected using a forward primer corresponding to nt 548 to 569 of ASPL (AAAGAAGTCCAAGTCGGGCCA) and a reverse primer corresponding to nt 972 to 993 in exon 4 of TFE3 (CGTTTGATGTTGGGCAGCTCA). Expected fragment sizes were 195 bp for ASPL-TFE3 type 1 and 300 bp for ASPL-TFE3 type 2.5 ASPS indicates alveolar soft part sarcoma; ASPL-TFE3, alveolar soft part locus-transcription factor E3.