Skip to main content
. 2020 Sep 25;10:15794. doi: 10.1038/s41598-020-72579-2

Table 3.

Primer sequences, predicted size of the amplified product and primer pair efficiency for the different genes examined in qRT-PCR.

Gene name Primer sequence (Fw) 5′–3′ Primer sequence (Rev) 5′–3′ Product length (bp) Primer pair efficiency
erCry4a tctgtctctgcttggtgacc ggggcactacatctctggaa 75 2.00
erCry4b agggattgagctcgtgtctc acatctcctctcctcatgcag 89 2.00
Protein kinase C alpha (Prkca) tgaaggctgaagtcactggt aagggtctgaaagtccatttgg 93 1.94
TATA box binding protein (Tbp) ggcagcaaggaagtatgcaa ctgaactgctggtgtgtgag 147 1.99
Glutamate Receptor 2 (GluR2) gtgattccaaggagaagaccag ccccgacgagaatgtagaaga 72 1.94