Skip to main content
. 2020 Sep 28;9:e60293. doi: 10.7554/eLife.60293

Key resources table.

Reagent type
(species) or resource
Designation Source or reference Identifiers Additional
information
Gene (Arabidopsis thaliana) PR1 arabidopsis.org At2G14610
Gene (Arabidopsis thaliana) SAG13 arabidopsis.org At2G29350
Gene (Arabidopsis thaliana) TI arabidopsis.org At1g73260
Gene (Arabidopsis thaliana) LecRK-I.8 arabidopsis.org At5g60280
Genetic reagent
(Arabidopsis thaliana)
lecrk-I.8 T-DNA Nottingham Arabidopsis stock center (NASC) SALK_066416
Genetic reagent
(Arabidopsis thaliana)
PR1::GUS Bruessow et al., 2010
Genetic reagent
(Arabidopsis thaliana)
SAG13::GUS Bruessow et al., 2010
Genetic reagent
(Arabidopsis thaliana)
TI::GUS Bruessow et al., 2010
Genetic reagent
(Arabidopsis thaliana)
sid2-1 Nawrath and Métraux, 1999
Genetic reagent
(Acinetobacter sp. ADPWH_lux.)
bacterial biosensor Huang et al., 2005
Sequence-based reagent PR1_FWD This paper PCR primers GTGGGTTAGCGAGAAGGCTA
Sequence-based reagent PR1_RV This paper PCR primers ACTTTGGCACATCCGAGTCT
Sequence-based reagent SAG13_FWD This paper PCR primers GTCGTGCATGTCAATGTTGG
Sequence-based reagent SAG13_RV This paper PCR primers CCAAGGACAAACAGAGTTCG
Sequence-based reagent TI_FWD This paper PCR primers CCTCGTGGTTGCTGGTCCAAA
Sequence-based reagent TI_RV This paper PCR primers CCTCTCACATAGTCTTGGACGAAA
Sequence-based reagent SAND_F This paper PCR primers AACTCTATGCAGCATTTGATCCACT
Sequence-based reagent SAND_R This paper PCR primers TGATTGCATATCTTTATCGCCATC