REAGENT or RESOURCE	SOURCE	IDENTIFIER
Antibodies
Sheep Anti-Digoxigenin Fab fragments Antibody, AP Conjugated	Roche, Sigma	Cat# 11093274910; RRID:AB_514497
Goat anti-Mouse IgG (H+L) Cross-Adsorbed Secondary Antibody, Alexa Fluor 488	Thermo Fisher Scientific	Cat# A-11001; RRID:AB_2534069
Spectrin, alpha antibody	Developmental Studies Hybridoma Bank	Cat# 3A9 (323 or M10-2); RRID:AB_528473
Mouse anti-Biotin antibody	Roche, Sigma	Cat# 1297597
Donkey anti-Sheep IgG (H+L) Cross-Adsorbed Secondary Antibody, Alexa Fluor 555	Thermo Fisher Scientific	Cat# A-21436; RRID:AB_2535857
Donkey anti-Mouse IgG (H+L) Highly Cross-Adsorbed Secondary Antibody, Alexa Fluor 647	Thermo Fisher Scientific	Cat# A-31571; RRID:AB_162542
Chemicals, Peptides, and Recombinant Proteins
Halocarbon oil 27	Sigma	Cat# H8773; CAS: 9002-83-9
Halocarbon oil 700	Sigma	Cat# H8898; CAS: 9002-83-9
5-bromo-4-chloro-3-indolyl-phosphate disodium salt (BCIP)	Sigma	Cat# B6149; CAS: 102185-33-1
4-Nitro blue tetrazolium chloride (NBT)	Roche, Sigma	Cat# 11585029001; CAS: 298-83-9
Digoxigenin-11-UTP	Roche, Sigma	Cat# 3359247910
DAPI	New England Biolabs	Cat# 4083; CAS: 28718-90-3
ProLongTM Diamond Antifade Mountant	Thermo Fisher Scientific	Cat# P36961
PermountTM	bioWORLD	Cat# 21750009
Western Blocking Reagent, Solution	Sigma	Cat# 11921673001
In-Fusion® HD Cloning Plus	TaKaRa	Cat# 638920
Experimental Models: Organisms/Strains
D.melanogaster; y1w67c23	Bloomington Drosophila Stock Center	RRID:BDSC_6599
D. melanogaster; y1w∗;P{His2Av-mRFP1}II.2; P{nos- MCP.EGFP}2	Bloomington Drosophila Stock Center	RRID:BDSC_60340
D. melanogaster; st2-dpp	Ashe et al., 2000	FBal0118266
D. melanogaster; y1w67c23; ΔPush/CyO	This study	N/A
D. melanogaster; y1M{vas-Cas9}ZH-2Aw118, ΔPhnt/FM7;	This study	N/A
D. melanogaster; y1w67c23; 24xMS2-ush	This study	N/A
D. melanogaster; y1M{vas-Cas9}ZH-2Aw118, 24xMS2-hnt;	This study	N/A
D. melanogaster; y1w67c23; hnt>24xMS2-ush	This study	N/A
D. melanogaster; y1M{vas-Cas9}ZH-2Aw118, ush>24xMS2-hnt;	This study	N/A
D.melanogaster; y1w67c23; MKRS, P{hsFLP}86E/TM6B, P{Crew}DH2, Tb1	Bloomington Drosophila Stock Center	RRID:BDSC_1501
D.melanogaster; y1M{vas-Cas9}ZH-2Aw118	Bloomington Drosophila Stock Center	RRID:BDSC_51323
Oligonucleotides
smFISH probes	Biosearch Technologies; 2BScientific, Table S1	N/A
Homology arm ush 1 fwd: gctagcacatatgcaGGTACCgtgcat agccacgacgttagg	Sigma	N/A
Homology arm ush 1 rev: cagttggggcactacGGTACCcgggg acgagacgagacctctta	Sigma	N/A
Homology arm ush 2 fwd: acgaagttatcACTAGTggaagtgacaacataattgcc	Sigma	N/A
Homology arm ush 2 rev: tggagatctttACTAGTtccaagccttcactccactc	Sigma	N/A
Homology arm hnt 1 fwd: cgctaccgcggGCTAGCgaagggttgctggtcacc	Sigma	N/A
Homology arm hnt 1 rev: cctgcatatgtGCTAGCcattgggtgcgtgtgtgtg	Sigma	N/A
Homology arm hnt 2 fwd: acgaagttatcACTAGTcaactgttgaacacaatttcac	Sigma	N/A
Homology arm hnt 2 rev: tggagatctttACTAGTcacacatgcatacatccagtc	Sigma	N/A
ush gRNA1 fwd: cttcgtctcgtctcgtccccgctc	Sigma	N/A
ush gRNA1 rev: aaacgagcggggacgagacgagac	Sigma	N/A
ush gRNA2 fwd: cttcgattatgttgtcacttcccgt	Sigma	N/A
ush gRNA2 rev: aaacacgggaagtgacaacataatc	Sigma	N/A
hnt gRNA1 fwd: cttcgcgcaaataggattacacat	Sigma	N/A
hnt gRNA1 rev: aaacatgtgtaatcctatttgcgc	Sigma	N/A
hnt gRNA2 fwd: cttcgattgtgttcaacagttgcga	Sigma	N/A
hnt gRNA2 rev: aaactcgcaactgttgaacacaatc	Sigma	N/A
Recombinant DNA
pCR4-24XMS2SL-stable	Bertrand et al.,1998	RRID:Addgene_31865
RIVcherry	Drosophila Genomics Resource Center	DGRC_ 1331
pTVcherry	Drosophila Genomics Resource Center	DGRC_1338
pU6-BbsI-chiRNA	Gratz et al., 2013	RRID:Addgene_45946
Software and Algorithms
FIJI (ImageJ)	NIH	RRID:SCR 002285
Imaris 9.2	Bitplane	RRID:SCR_007370
GraphPad Prism 8	GraphPad Software	RRID:SCR 002798
R	The R Foundation	https://www.r-project.org/
LAS X	Leica Microsystems Inc	https://www.cellularimaging.nl/leica-las-x/
Lightning Deconvolution	Leica	https://www.leica-microsystems.com/products/confocal-microscopes/p/lightning/
Huygens Professional Deconvolution	SVI (Scientific Volume Imaging)	RRID:SCR_014237 https://svi.nl/Huygens-Professional
Code analyzing FISH/smFISH data and calculating the midline	This study	https://github.com/TMinchington/sass, RRID:SCR_018797
Code combining single-cell traces and spot detection from live imaging movies and using Imaris output	This study	https://github.com/TMinchington/sass, RRID:SCR_018797
Modelling changes in transcription kinetics	J.R.B. et al., unpublished data	N/A
Other
Leica TCS SP8 AOBS inverted microscope	Leica	N/A
lumox® dish 50, Cell Culture Dish	Sarstedt AG & Co	Cat# 94.6077.305
Coverslips No 1 18x18mm	Scientific Laboratory Supplies	Cat# MIC3110
Coverslips No 0 18x18mm	Scientific Laboratory Supplies	Cat# MIC3100
Coverslips No 1.5 24x40mm	Scientific Laboratory Supplies	Cat# MIC3252
Wheaton vials	Sigma	Cat# Z188700-1PAK