Figure 3.

Direct LC–MS sequencing of modified RNA. In panels (a–d), circles denote compounds on the 5′ ladder (containing the original 5′ end) and squares denote those on the 3′ ladder (containing the original 3′ end). (a) Sequencing of an RNA that contains only canonical bases (R1: AUAGCCCAGUCAGUCUACGC). (b) Sequencing of a modified 20-nt RNA (R8: As²UCs²UCCCAGUCAGUCUACGC). (c) Sequencing of a 5′-biotinylated 15-nt RNA (R6: Biotin-GCGUAUACUGUCUCG). (d) Sequencing of a 20-nt RNA with the bulky hydrophobic 3′ modification Cy3 (R4: AUAGCCCAGUCAGUCUACGC-Cy3).