TABLE 1.
Bacterial strains, and primers used in this study.
| Strains | Description | Source or reference |
| Acinetobacter baumannii | ||
| ATCC® 17978TM | ATCCa | |
| ΔabaI (ATCC® 17978TM) | Δ0109 knock out (KO) mutant without synthase AHLs gene abaI (A1S_0109) | This study |
| Ab1 (ROC013) | A. baumannii clinical isolate (respiratory). TM: ST2 | López et al., 2017 |
| Ab4 (VAL001) | A. baumannii clinical isolate (respiratory). TM: ST169 | López et al., 2017 |
| Ab5 (DOM009) | A. baumannii clinical isolate (respiratory). TM: ST80 | López et al., 2017 |
| Ab7 (HUI001) | A. baumannii clinical isolate (respiratory). TM: ST79 | López et al., 2017 |
| MAR002 | A. baumannii biofilm hyper-producing clinical isolate (wound sample) TM: ST271 | Álvarez-Fraga et al., 2016 |
| Δ11085 | MAR002 mutant defective in biofilm formation and cell attachment | Álvarez-Fraga et al., 2016 |
| Acinetobacter nosocomialis | ||
| M2 | Niu et al., 2008 | |
| abaI:Km (M2) | abaI mutant (abaI:Km), Kmr | Niu et al., 2008 |
| Escherichia coli | ||
| BL21(DE3)plysS pET28c(+)-aii20J | E. coli containing a cloning vector (pET28c(+), Kmr) and aii20J gene from Tenacibaculum sp. 20J | Mayer et al., 2015 |
| BL21(DE3)plysS pET28c(+) | E. coli containing a cloning vector without the aii20J gene | Mayer et al., 2015 |
| Plasmids | Reference | Use in this work |
| pMo130 | GenBank: EU862243 | Construction of knockout strains |
| Primers | Sequence (5′–3′) | Use in this work |
| 0109UpFPstI | CCCCTGCAGGGGACTGGTGTCGTTATTACC | Construction of knockout strain Δ0109 |
| 0109UpREcoRI | GGGGAATTCCCCCTTGGAGTAGAACGTTTATTA | Construction of knockout strain Δ0109 |
| 0109DownFEcoRI | CCCGAATTCGGGACATAGGCTGTATCGACTT | Construction of knockout strain Δ0109 |
| 0109DownRBamHI | GGGGGATCCCCCACTGTAGAAATCCCTATACTT | Construction of knockout strain Δ0109 |
| 0109extF | TGTTCCCGATTATGTATG | Confirmation of Δ0109 |
| 0109extR | GCAACTTCACAAACTCCA | Confirmation of Δ0109 |
| pMo130site2F | ATTCATGACCGTGCTGAC | Checking of pMo130 |
| pMo130site2R | CTTGTCTGTAAGCGGATG | Checking of pMo130 |
aAmerican type culture collection.