Table 2.
Primers for detection and analysis of amh copies.
| Primer | Exon | Positiona | Target | Sequence |
|---|---|---|---|---|
| ILL2F | 7 | −25 | 233 bp deletion (amhΔy) | TGTGTTTTCTTTCTGCGTCCGCCA (Eshel et al. 2014) |
| ILL2R | 7 | 393 | AGCAGCTCTAGCGGCATCCACA (Eshel et al. 2014) | |
| Ins6F | 6 | 20 | 5 bp insertion (amhΔy) | CCGGCATCTCTGCAAACC |
| Ins6R | 6 | 305 | TGTCATTTGCACCAAAGTCTG | |
| E2F | 2 | 21 | Exon 2 | AAGACCCCATCATCACCATC (Eshel et al. 2014) |
| E6Ri | 6 | 51 | amhΔy | GGAAGCGTTTCATCGACATT |
| E6Rni | 6 | 46 | amh and amhy | AGGAAGCGTTTCATCTCACAA |
aThe number of nucleotide within an exon that corresponds to the start of the primer is indicated. Number of nucleotide following a minus sign refers to the position from the end of the preceding intron. Relative positions of primers are presented in Fig. 1.