Key resources table.
| Reagent type (species) or resource |
Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Strain, strain background (M. musculus, male and female) | CAG-CAT-EGFP |
Waclaw et al., 2010 |
||
| Strain, strain background (M. musculus, male and female) | Slc1a3(Glast)CreErt2 mice | Mori et al., 2006 | ||
| Strain, strain background (M. musculus, male and female) | Atg5fl/fl | Riken | B6.129S-Atg5 < tm1Myok> RRID:IMSR_RBRC02975 |
|
| Strain, strain background (M. musculus, male and female) | CD1 | Charles Rivers | Strain code: 022 | |
| Strain, strain background (M. musculus, male) | C57BL/6NCRL | Charles Rivers | Strain code: 027 | |
| Strain, strain background (M. musculus, male and female) | GFAP-GFP | Jackson | Strain code: 003257FVB/N-Tg(GFAPGFP)14Mes/J | |
| Transfected construct (Synthetic) | RV-GFP | Molecular Tool Platform, CERVO Brain Research Center | Lot #RV 39 | Retroviral construct |
| Transfected construct (Synthetic) | RV-Cre-mNeptune | Molecular Tool Platform, CERVO Brain Research Center | Lot #RV 34 | Retroviral construct |
| Transfected construct (R. norvegicus) | RV- RFP-GFP-LC3 | Molecular Tool Platform, CERVO Brain Research Center | Lot #RV15 | Retro viral construct |
| Transfected construct (Synthetic) | LV-CMV-PercevalHR | University of North Carolina Vector Core Facility | Lot #43–44213 PercevalHR | Lentiviral construct |
| Transfected construct (Synthetic) | LV-CMV-TdTomato | University of North Carolina Vector Core Facility | Lot #43–44213 TdTomato |
Lentiviral construct |
| Antibody | Anti-GFP (Rabbit polyclonal) | Thermo Fisher Scientific | Cat#A-11122; RRID:AB_221569 |
DAB (1:1000) |
| Antibody | Anti-GFP (Chicken polyclonal) | Avés | GFP-1020; RRID:AB_10000240 | IF (1:1000) |
| Antibody | Anti-LC3B (Rabbit polyclonal) | Novus | Cat#NB100-2220, RRID:AB_10003146 | IF (1:200) WB (1:1000) |
| Antibody | Anti- Cleaved LC3A (Rabbit polyclonal) | Abgent | Cat#AP1805a, RRID:AB_2137587 | IF (1:100) |
| Antibody | Anti-murine Atg5 (Rabbit polyclonal) | Novus | Cat#NB110-53818, RRID:AB_828587 | IF (1:400) |
| Antibody | Anti-LAMP-1 (CD107a) (Rabbit polyclonal) | Millipore | Cat#AB2971, RRID:AB_10807184 | IF (1:500) |
| Antibody | Anti-paxillin (Mouse monoclonal) |
BD Biosciences | Cat#610051, RRID:AB_397463 | IF (1:100) WB (1:1000) |
| Antibody | Anti-P62/SQSTM1 (Rabbit polyclonal) | Proteintech | Cat#18420–1-AP, RRID:AB_10694431 | WB (1:500) |
| Antibody | Anti-GAPDH (Mouse monoclonal) | Thermo Fisher Scientific | Cat#MA5-15738, RRID:AB_10977387 | WB (1:5000) |
| Antibody | Anti-rabbit IgG, biotin-SP conjugate (Goat polyclonal) | Millipore | Cat#AP132B, RRID:AB_11212148 | DAB (1:1000) |
| Antibody | Anti-GFP (Rabbit polyclonal) | Abcam | Cat#ab290, RRID:AB_303395 | EM (1:1000) |
| Antibody | Nanogold-Fab goat anti-rabbit | Nanoprobe | Cat#2004, RRID:AB_2631182 | EM (1:20) |
| Antibody | Anti-Atg12 (Rabbit polyclonal) | Abcam | Cat#ab155589 | IF (1:500) |
| Antibody | Anti-mCherry (16D7) (Rat monoclonal) | Thermo Fisher Scientific | Cat #M11217, RRID:AB_2536611 | IF (1:1000) |
| Recombinant DNA reagent | FUGW-PercevalHR (plasmid) | Addgene | RRID:Addgene_49083 | |
| Recombinant DNA reagent | pCSCMV:tdTomato (plasmid) | Addgene | RRID:Addgene_30530 | |
| Recombinant DNA reagent | ptfLC3 (plasmid) | Addgene | RRID:Addgene_21074 | |
| Recombinant DNA reagent | PU6-BbsI-CBh-Cas9-T2AmCherry (plasmid) | Addgene | RRID:Addgene_64324 | |
| Recombinant DNA reagent | pmRFP-LC3 (plasmid) | Addgene | RRID:Addgene_21075 | |
| Recombinant DNA reagent | pRK GFP paxillin (plasmid) | Addgene | RRID:Addgene_50529 | |
| Recombinant DNA reagent | GW1-pHRed (plasmid) | Addgene | RRID:Addgene_31473 | |
| Sequence-based reagent | Atg12-gRNA1-Fw | This paper | PCR primer | CGGAAACAGCCACCCCAGAG |
| Sequence-based reagent | Atg12-gRNA1-Rs | This paper | PCR primer | GCCCACTAACGGATGTTGACATTACTT |
| Sequence-based reagent | Atg12-gRNA2-Fw | This paper | PCR primer | ACGCTGCTACGTCACTTCC |
| Sequence-based reagent | Atg12-gRNA2-Rs | This paper | PCR primer | GCTCTGGAAGGCTCTCGC |
| Sequence-based reagent | Ulk1-gRNA1-Fw | This paper | PCR primer | TCGCAAGGACCTGATTGGAC |
| Sequence-based reagent | Ulk1-gRNA1-Rs | This paper | PCR primer | CCTCGCAATCCCGGACTC |
| Sequence-based reagent | Ulk1-gRNA2-Fw | This paper | PCR primer | CATCTGCTTTTTATCCCAGCA |
| Sequence-based reagent | Ulk1-gRNA2-Rs | This paper | PCR primer | CTGCAACAGAGCCAGGAG |
| Sequence-based reagent | Ulk2-gRNA1-Fw | This paper | PCR primer | TACTGCAAGCGGGACCT |
| Sequence-based reagent | Ulk2-gRNA1-Rs | This paper | PCR primer | TTTCGCACCAGACAACGGG |
| Sequence-based reagent | Ulk2-gRNA2-Fw | This paper | PCR primer | CTCTGAGTGAAGATACTATCAGAGTG |
| Sequence-based reagent | Ulk2-gRNA2-Rs | This paper | PCR primer | GATCCCTGTGGATTATCCCTTT |
| Commercial assay or kit | DNeasy Blood and Tissue Kit | Qiagen | Cat#69504 | |
| Commercial assay or kit | LightCycler 480 High Resolution Melting Master | Roche | Cat#04909631001 | |
| Commercial assay or kit | VECTASTAIN ABC-Peroxidase Kit | Vector Laboratories | Cat#PK4000 | |
| Commercial assay or kit | HQ Silver Enhancement kit | Product | Cat#2012 | |
| Chemical compound, drug | NeuroCult Proliferation Supplement | StemCell Technologies | Cat#05701 | |
| Chemical compound, drug | NeuroCult Basal Medium | StemCell Technologies | Cat#05700 | |
| Chemical compound, drug | EGF | Sigma-Aldrich | Cat#E4127 | |
| Chemical compound, drug | bFGF | Sigma-Aldrich | Cat#SRP4038-50UG | |
| Chemical compound, drug | Heparin | StemCell Technologies | Cat#07980 | |
| Chemical compound, drug | MgCl2 | Sigma-Aldrich | Cat#M8266; CAS 7786-30-3 | |
| Chemical compound, drug | Paraformaldehyde | Sigma-Aldrich | Cat#P6148; CAS: 30525-89-4 | |
| Chemical compound, drug | Tamoxifen | Sigma-Aldrich | Cat#T5648; CAS: 10540-29-1 | |
| Chemical compound, drug | Anhydrous ethyl alcohol | Commercial Alcohols | 1019C | |
| Chemical compound, drug | Sunflower seed oil | Sigma-Aldrich | Cat#S5007 CAS: 8001-21-6 | |
| Chemical compound, drug | Protease Inhibitor Cocktail Set III | Millipore | 539134 | |
| Chemical compound, drug | Blebbistatin | Research Chemicals Inc Toronto | Cat#B592490-10 CAS: 674289-55-5 | |
| Chemical compound, drug | GM6001 | Abmole | Cat#M2147-10MG CAS: 142880-36-2 |
|
| Chemical compound, drug | Y-27632 | Cayman Chemical | Cat#10005583–5 CAS: 129830-38-2 |
|
| Chemical compound, drug | Compound C | EMD Millipore | Cat#171260–10 MG CAS: 866405-64-3 |
|
| Peptide, recombinant protein | BDNF | Peprotech | Cat#450–02 | |
| Peptide, recombinant protein | GABA | Sigma-Aldrich | Cat#A5835-25G CAS: 56-12-2 |
|
| Software, algorithm | Imaris 7.2 | Bitplane, Oxford Instrument | https://imaris.oxinst.com/ | |
| Software, algorithm | MATLAB 2016a | Mathworks | https://www.mathworks.com/ | |
| Software, algorithm | MATLAB scripts PercevalHR imaging analysis | This paper | https://github.com/SagLab-CERVO/PercevalHR-fluorescence-intensity | To track cell and measure PercevalHR fluorescence intensity (Labrecque et al., 2020; copy archived at https://github.com/elifesciences-publications/PercevalHR-fluorescence-intensity) |
| Software, algorithm | ImageJ | NIH | https://imagej.net/Welcome | |
| Software, algorithm | Origin 2016 | OriginLab Corporation | https://www.originlab.com/ | |
| Software, algorithm | Statistica 6.1 | Stat Soft | N/A | |
| Software, algorithm | Primer-Blast software | NCBI | https://www-ncbi-nlm-nih-gov.acces.bibl.ulaval.ca/tools/primer-blast/ | |
| Software, algorithm | ChopChop online software | Labun et al., 2019 | https://chopchop.cbu.uib.no/ | |
| Software, algorithm | LightCycler 480 SW1.5.1 software | Roche | 04994884001 |