Skip to main content
. 2020 Aug 20;2(10):600–612. doi: 10.1096/fba.2020-00022

Table 1.

DNA sequence of broken beacon probes and location of attached modifications. TAMRA is excited at a wavelength of 557 nm and emits at a wavelength of 583 nm. BHQ2 maximally quenches at 579 nm.

DNA Sequence 5′ – 3′ Modifications
ttcacatttcatcgacggacaacg 5′ – TAMRA
cgatgaaatgtgaa 3′ – BHQ2