Table 2.
Primers for mmsA template DNA.
| Direction | DNA Sequence 5′ – 3′ |
|---|---|
| Forward | catgcatgcatatgctagccatgatggagcgcag |
| Reverse | catgcatgaagcttcagctcggccaactcgtcga |
Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.