Key resources table.
| Reagent type (species) or resource |
Designation | Source or reference |
Identifiers | Additional information |
|---|---|---|---|---|
| Strain, strain background (C. elegans) |
N2;Pdaf-7::flp-mCherry;
Punc-122::GFP |
This paper | SSR1164 | Integrated. Backcrossed 6X. See Methods section “Cloning and transgenic strain construction” |
| Strain, strain background (C. elegans) |
N2;Phsp-60::GFP | Nargund et al., 2012 | Integrated. | |
| Strain, strain background (C. elegans) |
N2;Pdaf-7::flp-mCherry; Punc-122:: GFP;Phsp-60::GFP | This paper | SSR1488 | Integrated. See Methods section “Cloning and transgenic strain construction” |
| Strain, strain background (C. elegans) |
atfs-1(tm4525)V | Nargund et al., 2012 | ||
| Strain, strain background (C. elegans) |
atfs-1(tm4525);Pdaf-7::flp-7mCherry | This paper | SSR1481 | Integrated. See Methods section “Cloning and transgenic strain construction” |
| Strain, strain background (C. elegans) |
atfs-1(tm4525); Phsp-60::GFP | Nargund et al., 2012 | Integrated. Backcrossed 1X. |
|
| Strain, strain background (C. elegans) |
atfs-1(tm4525); Pdaf-7::flp-7mCherry;Punc-122::GFP; Phsp-60::GFP | This paper | SSR1571 | Integrated. Backcrossed 1X. See Methods section “Cloning and transgenic strain construction” |
| Strain, strain background (C. elegans) |
N2;Patgl-1::GFP | This paper | SSR1564 | Integrated. Backcrossed 7X. See Methods section “Cloning and transgenic strain construction” |
| Strain, strain background (C. elegans) |
N2;Pdaf-7::flp-7mCherry;Punc-122::GFP;Patgl-1::GFP | This paper | SSR1503 | Integrated. Backcrossed 7X. Originated from N2;Pdaf-7::flp-7mCherry;Punc-122::GFP and N2;Patgl-1::GFP |
| Strain, strain background (C. elegans) |
hlh-11(ok2944)III | This paper | SSR725 | Backcrossed 7X. See Methods section “Worm maintenance and strains” |
| Strain, strain background (C. elegans) |
hlh-11(ok2944);Pdaf-7::flp-7mCherry;Punc-122::GFP | This paper | SSR1560 | Integrated. Originated from hlh-11(ok2944) and N2;Pdaf-7::flp-7mCherry;Punc-122::GFP |
| Strain, strain background (C. elegans) |
hlh-11(ok2944);Patg-1::GFP | This paper | SSR1563 | Integrated. Backcrossed 7X. Originated from hlh-11(ok2944) and N2;Patg-1::GFP |
| Strain, strain background (C. elegans) |
hlh-11(ok2944);Pdaf-7::flp-7mCherry;Punc-122::GFP; Patg-
1l::GFP |
This paper | SSR1536 | Integrated. Backcrossed 7X. Originated from hlh- 11(ok2944); Pdaf-7::flp-mCherry; Punc-122::GFP and N2;Patg-1::GFP |
| Strain, strain background (C. elegans) |
N2;Phlh-11::hlh-11GFP | This paper | SSR1530 | Integrated. Backcrossed 4X. See Methods section “Cloning and transgenic strain construction” |
| Strain, strain background (C. elegans) |
N2;Pdaf-7::flp-7mCherry;Punc-122::GFP;Phlh-11::hlh-
11GFP |
This paper | SSR1550 | Integrated. Backcrossed 5X. Originated from N2;Pdaf-7::flp-mCherry; Punc-122::GFP and N2;Phlh-11::hlh-11GFP |
| Strain, strain background (C. elegans) |
N2;Patgl-1Δcishlh-11::GFP | This paper | SSR1567 | Extrachromosomal. See Methods section “Cloning and transgenic strain construction” |
| Strain, strain background (C. elegans) |
hlh-11(ok2944);atfs-1(tm4525) | This paper | SSR1399 | Originated from hlh-11(ok2944) and atfs-1(tm4525) |
| Strain, strain background (C. elegans) |
hlh-11(ok2944);atfs-1(tm4525);Pdaf-7::flp-7mCherry;Punc-
122::GFP |
This paper | SSR1538 | Integrated. Originated from hlh-11(ok2944);atfs-1(tm4525) and N2;Pdaf-7::flp-7mCherry;Punc-122::GFP |
| Antibody | GFP-Trap coupled to magnetic agarose beads (Camelidae antibody) | Bulldog Bio | Cat# GTMA020 | ChIP (20 uL per 3 mg of protein) |
| Recombinant DNA reagent | Phlh-11::hlh-11GFP (plasmid) | This paper | pSS1222 | See Methods section “Cloning and transgenic strain construction” |
| Recombinant DNA reagent |
Patgl-1::GFP
(plasmid) |
Noble et al., 2013 | pSS496 | |
| Recombinant DNA reagent | Patgl-1Δcishlh-11::GFP (plasmid) | This paper | pSS1245 | See Methods section “Cloning and transgenic strain construction” |
| Sequence-based reagent | Forward primer for cloning the promoter of hlh-11 | IDT | 5’-ggggacaactttgtatagaaaagttggagtgtggtgtgtttctcgtcag -3’ | |
| Sequence-based reagent | Reverse primer for cloning the promoter of hlh-11 | IDT | 5’-ggggactgcttttttgtacaaacttgtcattttctactattgatctacctg -3’ | |
| Sequence-based reagent | Forward primer for cloning the hlh-11 gene | IDT | 5’- ggggacaagtttgtacaaaaaagcaggcttggttcgttcggatag -3’ | |
| Sequence-based reagent | Reverse primer for cloning the hlh-11 gene | IDT | 5’- ggggaccactttgtacaagaaagctgggtaacggacgagcgatgtctg -3’ | |
| Sequence-based reagent | Forward primer to remove the upstream hlh-11 cis-site in the Patgl-1::GFP plasmid | IDT | 5’- gcactaactatttttttgttcgttcattttc -3’ | |
| Sequence-based reagent | Reverse primer to remove the upstream hlh-11 cis-site in the Patgl-1::GFP plasmid | IDT | 5’- cctcctgtctcggaacgc -3’ | |
| Sequence-based reagent | Forward primer to remove the downstream hlh-11 cis-site in the Patgl-1::GFP plasmid | IDT | 5’- aatgattacataaagtcacg -3’ | |
| Sequence-based reagent | Reverse primer to remove the downstream hlh-11 cis-site in the Patgl-1::GFP plasmid | IDT | 5’- atcttgctatgaatgtacc -3’ | |
| Sequence-based reagent | qPCR forward primer for act-1 | IDT | 5’- gtatggagtccgccgga -3’ | |
| Sequence-based reagent | qPCR reverse primer for act-1 | IDT | 5’- cttcatggttgatggggcaa -3’ | |
| Sequence-based reagent | qPCR forward primer for atgl-1 | IDT | 5’- ctaccactgcaatgggaatct -3’ | |
| Sequence-based reagent | qPCR reverse primer for atgl-1 | IDT | 5’- gtgggctgaccatatccaaata -3’ | |
| Sequence-based reagent | qPCR forward primer for hlh-11 | IDT | 5’- gcgcagaagaagatcaaatcatc -3’ | |
| Sequence-based reagent | qPCR reverse primer for hlh-11 | IDT | 5’- ggtgccattcgtgcatttg -3’ | |
| Sequence-based reagent | qPCR forward primer for hsp-60 | IDT | 5’- cgagcttatcgagggaatgaa -3’ | |
| Sequence-based reagent | qPCR reverse primer for hsp-60 | IDT | 5’- gccttctcgtactcgactttag -3’ | |
| Sequence-based reagent | ChIP-qPCR forward primer set 1 for Patgl-1 | IDT | 5’- cgtggggtacggtacattca -3’ | |
| Sequence-based reagent | ChIP-qPCR reverse primer set 1 for Patgl-1 | IDT | 5’- ttggctagcgtgtagtgacg -3’ | |
| Sequence-based reagent | ChIP-qPCR forward primer set 2 for Patgl-1 | IDT | 5’- cgtcactacacgctagccaa -3’ | |
| Sequence-based reagent | ChIP-qPCR reverse primer set 2 for Patgl-1 | IDT | 5’- cagccaggtggtgatggaat -3’ | |
| Sequence-based reagent | ChIP-qPCR forward primer set 3 for Patgl-1 | IDT | 5’- gtgatggcgttccgagacag -3’ | |
| Sequence-based reagent | ChIP-qPCR reverse primer set 3 for Patgl-1 | IDT | 5’- ggtaccatactggtacaaacg -3’ | |
| Chemical compound, drug | Serotonin (5-HT) | Alfa Aesar | Cat. # B21263-03 | 5 mM |
| Software, algorithm | ImageJ | Schindelin et al., 2012 | https://imagej.net/Fiji | |
| Software, algorithm | GraphPad Prism | https://graphpad.com | Version 8.0.0 |