Table 2.
Frequency, conservation, and predicted functional impact of MFSD2A variants.
| MFSD2A variant [NM_032793.5] | g. (hg19) | LOVD (ID) | Internal database‡ | ExAC/gnomAD | GME | Iranome | Ensembl | ClinVar | SIFT | Mutation Taster | HSF/VEP | GERP score | CADD score | ACMG class |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| c.476C>T (p.Thr159Met) | chr1:40431005C>T | 00276075 | − | 0.000003978 (1 het) | − | − | rs1057517688 | Pathogenic | Damaging (score 0) | Disease causing | − | 5.75 | 34 | Likely pathogenic (PS3, PM2, PP3, PP4, PP5) |
| c.593C>T (p.Thr198Met) | chr1:40431565C>T | 00276071 | − | 0.000003977 (1 het) | − | − | rs756467073 | − | Damaging (score 0.003) | Disease causing | − | 5.94 | 28.2 | Likely pathogenic (PS3, PM2, PP3, PP4) |
| c.556+1G>A | chr1:40431222G>A | 00276070 | − | 0.000003978 (1 het) | − | − | rs758953000 | − | − | Disease causing | WT donor site alteration | 5.56 | 29.2 | Pathogenic (PVS1, PM2, PP3, PP4) |
| c.750_753del (p.Cys251SerfsTer3) | chr1:40432304 TTGTC>T | 00276077 | − | 0.000003982 (1 het) | − | − | − | − | − | Disease causing | − | − | − | Pathogenic (PVS1, PM2, PP4) |
| c.748G>T (p.Val250Phe) | chr1:40432306G>T | 00276074 | − | − | − | − | − | − | Damaging (score 0) | Disease causing | − | 5.79 | 33 | Likely pathogenic (PS3, PM2, PP3, PP4) |
| c.977G>A (p.Arg326His) | chr1:40432807G>A | 00276074 | − | 0.000007956 (2 het) | − | − | rs776741331 | − | Tolerated (0.37 score) | Disease causing | − | 5.52 | 24.4 | Likely pathogenic (PS3, PM2, PP3, PP4) |
| c.1386_1435del (p.Gln462HisfsTer17) | chr1:40434271GCAGCCGGAACGTGTCAAGTTTACACTGAACATGCTCGTGACCATGGCTCC>G | 00276076 | − | − | − | − | − | − | − | Disease causing | − | − | − | Pathogenic (PVS1, PM2, PP4) |
| c.1478C>T (p.Pro493Leu) | chr1:40434366C>T | 00276067 | − | − | − | − | − | − | Damaging | Disease causing | − | 5.49 | 32 | Likely pathogenic (PS3, PM2, PP3, PP4) |
ACMG American College of Medical Genetics and Genomics, CADD Combined Annotation Dependent Depletion, GERP Genomic Evolutionary Rate Profiling, GME Greater Middle East Variome Project, HSF Human Splice Finder, LOVD-ID Leiden Open Variation Database Identifier, PVS pathogenic very strong, PS pathogenic strong, PM pathogenic moderate, PP pathogenic supporting, SIFT Sorting Intolerant From Tolerant, VEP Variant Effect Predictor, VUS variant of unknown significance.
‡Database of 10,000 in-house control exomes.