Skip to main content
. 2020 Jun 22;28(11):1509–1519. doi: 10.1038/s41431-020-0669-x

Table 2.

Frequency, conservation, and predicted functional impact of MFSD2A variants.

MFSD2A variant [NM_032793.5] g. (hg19) LOVD (ID) Internal database ExAC/gnomAD GME Iranome Ensembl ClinVar SIFT Mutation Taster HSF/VEP GERP score CADD score ACMG class
c.476C>T (p.Thr159Met) chr1:40431005C>T 00276075 0.000003978 (1 het) rs1057517688 Pathogenic Damaging (score 0) Disease causing 5.75 34 Likely pathogenic (PS3, PM2, PP3, PP4, PP5)
c.593C>T (p.Thr198Met) chr1:40431565C>T 00276071 0.000003977 (1 het) rs756467073 Damaging (score 0.003) Disease causing 5.94 28.2 Likely pathogenic (PS3, PM2, PP3, PP4)
c.556+1G>A chr1:40431222G>A 00276070 0.000003978 (1 het) rs758953000 Disease causing WT donor site alteration 5.56 29.2 Pathogenic (PVS1, PM2, PP3, PP4)
c.750_753del (p.Cys251SerfsTer3) chr1:40432304 TTGTC>T 00276077 0.000003982 (1 het) Disease causing Pathogenic (PVS1, PM2, PP4)
c.748G>T (p.Val250Phe) chr1:40432306G>T 00276074 Damaging (score 0) Disease causing 5.79 33 Likely pathogenic (PS3, PM2, PP3, PP4)
c.977G>A (p.Arg326His) chr1:40432807G>A 00276074 0.000007956 (2 het) rs776741331 Tolerated (0.37 score) Disease causing 5.52 24.4 Likely pathogenic (PS3, PM2, PP3, PP4)
c.1386_1435del (p.Gln462HisfsTer17) chr1:40434271GCAGCCGGAACGTGTCAAGTTTACACTGAACATGCTCGTGACCATGGCTCC>G 00276076 Disease causing Pathogenic (PVS1, PM2, PP4)
c.1478C>T (p.Pro493Leu) chr1:40434366C>T 00276067 Damaging Disease causing 5.49 32 Likely pathogenic (PS3, PM2, PP3, PP4)

ACMG American College of Medical Genetics and Genomics, CADD Combined Annotation Dependent Depletion, GERP Genomic Evolutionary Rate Profiling, GME Greater Middle East Variome Project, HSF Human Splice Finder, LOVD-ID Leiden Open Variation Database Identifier, PVS pathogenic very strong, PS pathogenic strong, PM pathogenic moderate, PP pathogenic supporting, SIFT Sorting Intolerant From Tolerant, VEP Variant Effect Predictor, VUS variant of unknown significance.

Database of 10,000 in-house control exomes.