Key resources table.

Reagent type (species) or resource	Designation	Source or reference	Identifiers	Additional information
Sequence-based reagent	Forward primer to construct the deletion cassette for the ADE2 gene in SpC	Charron et al., 2019	CLOP97-F5	acaattaaggaatcaagaaaccgt gataaaaaattcaagt CAGCTGAAGCTTCGTACGC
Sequence-based reagent	Reverse primer to construct the deletion cassette for the ADE2 gene in SpC	Charron et al., 2019	CLOP97-F6	gtaattgttcgctggccaagtata ttaatacatttatata GCATAGGCCACTAGTGGATC
Strain, strain background (Saccharomyces paradoxus)	Haploid parent for MA lines	Charron et al., 2014	LL2011_001 MATa hoΔ::kanMX4
Strain, strain background (Saccharomyces paradoxus)	Haploid parent for MA lines	This study	LL2011_001 MATa hoΔ::kanMX4 ade2Δ::hphNT1	Haploid yeast strain with ho and ade2 deletions. See Materials and methods section Mutation accumulation
Strain, strain background (Saccharomyces paradoxus)	Haploid parent for MA lines	Leducq et al., 2016	LL2011_012 MATa hoΔ::kanMX4
Strain, strain background (Saccharomyces paradoxus)	Haploid parent for MA lines	This study	LL2011_012 MATa hoΔ::kanMX4 ade2Δ::hphNT1	Haploid yeast strain with ho and ade2 deletions. See Materials and methods section Mutation accumulation
Strain, strain background (Saccharomyces paradoxus)	Haploid parent for MA lines	Charron et al., 2014	MSH-587–1 MATa hoΔ::natMX4
Strain, strain background (Saccharomyces paradoxus)	Haploid parent for MA lines	This study	MSH-587–1 MATa hoΔ::natMX4 ade2Δ::hphNT1	Haploid yeast strain with ho and ade2 deletions. See Materials and methods section Mutation accumulation
Strain, strain background (Saccharomyces paradoxus)	Haploid parent for MA lines	Charron et al., 2019	LL2011_004 MATα hoΔ::kanMX4 ade2Δ::hphNT1
Strain, strain background (Saccharomyces paradoxus)	Haploid parent for MA lines	Charron et al., 2019	LL2011_009 MATα hoΔ::natMX4 ade2Δ::hphNT1