Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.
Primers used for PCR analysis
| Title of the primer | Sequence of oligonucleotides (5′- > 3′) | Site of flanking beginning | Site of flanking end |
|---|---|---|---|
| Forvard primer AP | GCTCTCCTGGCTACTGACC | 4772 | 791 |
| Reverse primer ZM2 | CTCTGATGGCTAAGGGCAGACACGGC | 5822 | 848 |
| Reverse primer ZM5 | GCTAGGCCTAAGGTCAGGGCCGC | 5743 | 766 |
