Table 2.

Sequences of primers used in the amplification of leptin, ghrelin, adiponectin receptors, and GAPDH of chicken broilers fed diets containing varying concentrations of lysine from hatch to 8 WOA.

Receptor and accession No	Primer sequence1	Amplicon length (bp)	Product length	Tm2 (°C)
Leptin NM_204323.1	Forward: 5′ CACTCGCTGGGAACACTTGA 3′	20	116	56.0
	Reverse: 5′ TTCAGCAGCCCATCGTTTCT3′	20	116	56.0
Ghrelin NM_204394.1	Forward: 5′ TGCCTTTTCACGTAGGACGA 3′	20	118	54.0
	Reverse: 5′ GCGCTCAGGTAGAAGAGGAC 3′	20	118	54.0
Adiponectin AY786316.1	Forward: 5′ TGATCCCCAGGTCTACAAGG 3′	20	235	55.0
	Reverse: 5′ TGCTGCTGTCGTAGTGGTTC 3′	20	235	55.0
GAPDH3	Forward: 5′ AGAACATCATCCCAGCGTCC 3′	20	133	56.0
NM_204305.1	Reverse: 5′ CGGCAGGTCAGGTCAACAAC 3′	20	133	56.0

Abbreviations: GAPDH, glyceraldehyde-3-phosphate dehydrogenase; WOA, weeks of age.

¹Chicken primers for leptin, ghrelin, and adiponectin receptors.

²Tm represents the optimized primer annealing temperature.

³The GADPH was used as internal controls.