Skip to main content
NCBI home page
Poultry Science logoLink to Poultry Science
. 2020 Mar 10;99(4):1896–1905. doi: 10.1016/j.psj.2019.12.004

Effects of induced stress from the live LaSota Newcastle disease vaccination on the growth performance and immune function in broiler chickens

RF Li ∗, SP Liu ∗, ZH Yuan ∗, JE Yi ∗, YN Tian †, J Wu ∗,1, LX Wen ∗,1
PMCID: PMC7587897  PMID: 32241469

Abstract

This study was conducted to assess the growth performance and immunological effects of vaccination-induced stress on broilers. The chickens were administered 0, 2, 4, 8, and 16 doses of live LaSota Newcastle disease (ND) vaccine and slaughtered on the 1st, 7th, 14th, and 21st day post vaccination. The results showed that the serum antibody titers after Newcastle disease virus (NDV) vaccination were elevated at day 7 post vaccination, peaked at day 14, then declined by day 21. Interestingly, the antibody titers peaked at 2 doses, and no further dose-dependent titer increases were observed. This study demonstrated that vaccination-induced stress increased serum adrenocorticotropic hormone and cortisol, affected growth performance (average daily gain, average daily feed intake, and feed conversion ratio), and triggered apoptosis in spleen lymphocytes by downregulating the ratio of Bcl-2 to BAX and upregulating the gene expressions of caspase-3 and -9, which was concordant with the activation of the enzymatic activities of caspase-3 and -9. This study suggests that NDV vaccine doses in broilers must be controlled judiciously because increasing the number of doses resulted in increased lymphocyte apoptosis while the peak of the antibody titer and optimal growth performance were achieved at a low number of doses (2 doses).

Key words: Newcastle disease vaccine, immune stress, immune function, lymphocyte apoptosis, broiler

Introduction

Under high-density rearing conditions for the mass production, farm animals are often at risk of developing subclinical health problems, and are inevitably affected by various stress factors and constraints, such as feeding management and environmental, social, physiological, psychological and pathological factors, and feeding management (Shini and Kaiser, 2009). All these factors can directly or indirectly alter immune responses and induce immune stresses (Wilkinson et al., 2011). Under immune stress, the animal’s metabolic priorities will be rearranged, resulting in the redistribution of nutrients. The anabolism of animal body protein and fat will be abated, while catabolism will be heightened, in order to satisfy the requirement of nutrient requirements to support the immune system (Johnson, 1997). Immune stress also can dysregulate immune responses (Glaser and Kiecolt-Glaser, 2005, Chrousos and Kino, 2007) by altering the balance of cytokines and reducing the absolute numbers, trafficking, and function of immune cells (Hangalapura et al., 2006, Shini and Kaiser, 2009, Shini et al., 2010). At the same time, the internal nutrient consumption of the animal will increase with a decline in appetite and growth performance (Jacobi et al., 2006), which will cause economic losses to the animal husbandry industry (Li et al., 2017).

Although poultry experience various immune stresses starting at the hatchery, one of the most commonly experienced immune stresses is caused by vaccination. Vaccinations are considered necessary to prevent infection and the replication of viruses, and to reduce the incidence and mortality rates that occur in modern poultry breeding (Feng et al., 2012). On the other hand, rapid and multiple vaccinations are usually associated with a high stress load, which inhibits many immune functions leading to immune paralysis and the development of diseases (Kaab et al., 2018). In practical poultry husbandry environments, inactivated vaccines are often administered in large doses at high frequencies, which can cause immune stress (Yang et al., 2011, Feng et al., 2012).

Despite the extensive researches, the mechanisms of immune stress have not been well understood. Previous studies have shown the growth retardation associated with immune stress (Takahashia et al., 1997, Li et al., 2015). To our knowledge, few studies have analyzed the potential effects of vaccination-induced immune stress on broiler chicken physiology and growth. The present experiment was designed to investigate the effect of vaccination-induced stress on broiler comprehensive growth performance, antibody titers, serum hormone levels, spleen lymphocyte apoptosis, and gene expressions, which provides an experimental basis for the clinical use of Newcastle disease (ND) vaccine.

Materials and methods

Animals and Management

A total of 200 one-day-old Arbor Acres broiler chickens of both sexes were acquired from the Hunan Institute of Animal and Veterinary Science. The chicks were fed with a commercially available chick crumb formulated to meet or exceed the National Research Council (NRC, 1994) guidelines. The animal protocol for the present study was approved by the Animal Care and Use Committee of the Hunan Agriculture University (Hunan, China). Food and water were provided ad libitum. The initial temperature inside the room was maintained at 35°C ± 0.5°C for 2 D and was then decreased by 2°C to 3°C each consecutive week until the room temperature reached 25°C. The lighting program was 23 h of light for the first 2 wk, and 16 h of light afterwards. The initial body weight of chicks did not differ among treatments (P > 0.05).

Experimental Design

The chicks were randomly and equally assigned to 5 treatment groups. They were nasally vaccinated with 2, 4, 8, and 16 doses of a live Newcastle disease virus (NDV) vaccine (LaSota strain, Hunan Zhongan Biopharmaceutical Co., Ltd., Changsha, China) on day 13 of age, and the control group (NC) was administrated with equivalent amounts of sterile saline and reared in isolation. Ten birds from each group were randomly weighed and slaughtered on the 1st, 7th, 14th, and 21st day post vaccination, and the blood and lymphoid organs were collected. Approximately 8 mL of blood was collected from the jugular vein, and it was stored at room temperature for 2 h followed by centrifugation at 3,000 g for 15 min and stored at −80°C for subsequent analysis.

Serum Antibody Titers to NDV

Newcastle disease virus antibody quantification was performed by the antigen. The geometric mean titer was expressed as reciprocal log2 values of the greatest dilution that displayed hemagglutination inhibition.

Serum Adrenocorticotropic Hormone and Cortisol

The concentrations of serum adrenocorticotropic hormone (ACTH) and cortisol (CORT) were determined by using available radio immune assay kits (Beijing North Institute of Biological Technology, Beijing, China), according to the manufacturer’s instructions.

Performance Parameters

BW and feed intake were measured to determine ADG, ADFI, and the FCR (feed to gain ratio). The lymphoid organs including spleen, thymus, and bursa of Fabricius were dissected from each bird and weighed immediately. Then, the lymphoid organ index was expressed relative to the BW (g of organ/kg of BW).

Spleen Lymphocyte Preparation

The spleen tissues were harvested using aseptic techniques after the chicks were sacrificed. The spleens were immediately placed in saline, and washed 3 times with sterilized cold PBS. Then, the splenocytes were passed through the mesh aperture of a 100-μm cell strainer and carefully layered on the surface of the lymphocyte separation medium (Tianjin Haoyang Biological Manufacture Co., Ltd., Tianjin, China) to acquire a single cell suspension. The red blood cells of the spleens were lysed with a red blood cell lysis reagent (Beijing Solarbio Science and Technology Co., Ltd., Beijing, China). The lymphocytes were washed twice with PBS and resuspended in completed RPMI 1640 medium (Beijing Solarbio Science and Technology Co., Ltd.) supplemented with 10% fetal bovine serum (Hangzhou Sijiqing Bioengineering Materials Co., Ltd., Hangzhou, China), 1% penicillin-streptomycin (Beijing Solarbio Science and Technology Co., Ltd.), and 1% glutamine (Beijing Solarbio Science and Technology Co., Ltd.), and cell number was counted and used for subsequent analysis.

Analysis of Apoptosis

The separated lymphocytes were centrifuged at 800 g for 5 min and washed twice with PBS. The cells were examined for apoptosis using the Annexin V-FITC apoptosis detection kit (Life Sciences Solutions group, Thermo Fisher Scientific Inc.). Briefly, 5 μL of FITC-conjugated Annexin V and 5 μL of PI were added to the suspension, and the cells were incubated in the dark at 4°C followed by analysis using a flow cytometer (FACS Calibur; BD Biosciences, Germany) within 1 h after staining.

Real-Time Polymerase Chain Reaction

Total RNA was isolated from the frozen spleens of the chickens using TRIzol reagent (Invitrogen, Carlsbad, CA). The concentrations and purity of the total RNA were detected by a spectrophotometer (Nanodrop 2000, Thermo Scientific) at OD 260/280 nm. Subsequently, the RNA was transcribed to cDNA using a Prim-Script RT Reagent Kit (RR047A, Takara, Japan) according to the manufacture's protocols. The cDNA was used as a template for real-time PCR analysis. Sequences for the target genes (Bcl-2, BAX, caspase-3, -9, and β-actin) were obtained from the NCBI database. Oligonucleotide primers were designed using the Primer 5.0 software and synthesized at Sangon Biotech (Wuhan, China) (Table 1).

Table 1.

Details of primers of the apoptotic genes in real-time PCR quantitative analysis.

Gene symbol Accession number Primer sequence (5′–3′) Product size (bp)
Bcl-2 NM_205339.1 Forward: ATCGTCGCCTTCTTCGAGTT 146
Reverse: ATCCCATCCTCCGTTGTCCT
Bax XM_422067.4 Forward: GTGATGGCATGGGACATAGCTC 104
Reverse: TGGCGTAGACCTTGCGGATAA
Caspase-3 NM_204725 Forward: AAAGATGGACCACGCTCAGG 189
Reverse: TCCGGTATCTCGGTGGAAGT
Caspase-9 AY057940 Forward: CGAAGGAGCAAGCACGACAG 130
Reverse: CCGCAGCCCTCATCTAGCAT
β-Actin NM_205518.1 Forward: ATTGTCCACCGCAAATGCTTC 113
Reverse: AAATAAAGCCATGCCAATCTCGTC
Open in a new tab

The mRNA expression levels of the target genes were quantified by real-time PCR using a SYBR green premix according to the manufacturer’s instructions (RR820A Takara, Japan). The real-time PCR reaction conditions were as follows: pre-incubation at 95°C for 30 s, followed by 40 cycles of 95°C for 5 s and 60°C for 30 s, and a final step of 95°C for 30 s, 60°C for 1 min, and 95°C for 15 s. The real-time PCR occurred in a thermal cycler (CFX Connect, Bio-Rad). The gene expression calibrations were the gene expression values of the control group at 1, 7, 14, and 21 D post vaccination. The chicken β-actin as a house keeping gene was used as an internal parameter. The results were analyzed by the 2−ΔΔCt method as described by the manufacturer and were expressed as fold increases over the indicated control groups. All PCR operations were performed in triplicate.

Caspase Activity Assays

The separated lymphocytes were centrifuged at 800 g for 5 min, washed twice with PBS, and collected. The activities of caspase-3 and -9 were examined by the Colorimetric Caspase-3 and -9 Assay Kit (Beyotime Institute of Biotechnology, Jiangsu, China) according to the manufacturer’s instructions. Briefly, the cells were incubated with lysis buffer on ice for 15 min and centrifuged at 12,000 g for 10 min. For each well in a 96-well microplate, the cell lysate (50 μL), assay buffer (40 μL), and caspase 3 substrate (acetyl-Asp-Glu-Val-Asp p-nitroanilide (Ac-DEVD-pNA), 10 μL) or caspase 9 substrate (acetyl-Leu-Glu-His-Asp p-nitroanilide (Ac-LEHD-pNA), 10 μL) were combined. The activities of caspase-3 and -9 were quantified by a spectrophotometer at a wavelength of 405 nm, and the data were normalized to the control group.

Statistical Analysis

All data were expressed as the mean ± standard error of the mean. One-way ANOVA was used for statistical comparisons. A P value of < 0.05 was deemed statistically significant. Graphs were plotted using GraphPad Prism 4 (GraphPad Software, Inc., San Diego, CA).

Results

Effects of the Immune Response to the ND Vaccine on the Serum Antibody Titers

In response to vaccination, the serum antibody titers to the ND vaccine were increased (P < 0.001) in all the vaccinated groups as compared with the control post vaccination (Figure 1). The serum antibody response increased in a time-dependent manner (P < 0.001) in the vaccinated groups, and the peak level occurred at day 14. The serum antibody response then decreased, but still remained at a significantly higher level (P < 0.001) than that in the control. Comparing across all treatment groups, the titers of the antibodies peaked at 2 doses, and there were no dose-dependent titer increases beyond 2 doses up to 16 doses.

Figure 1.

Figure 1

Open in a new tab

Serum antibody titers (log2) to different doses of Newcastle disease (ND) vaccination of broilers at 1, 7, 14, and 21 D post vaccination. Each experiment includes NC group (non-vaccination group, control) and vaccinated groups (groups which were vaccinated with 2, 4, 8, and 16 doses of ND vaccine by nose-drop on day 13 of age, respectively). Values represent mean ± SEM. *P < 0.05, **P < 0.01 compared with NC group; #P < 0.05, ##P < 0.01 compared with routine dose (2 doses) of vaccinated group.

Effects of Vaccination-Induced Stress on Serum ACTH and CORT

Because immunological stress would activate the hypothalamic–pituitary–adrenal (HPA) axis, contributing to the release of ACTH and CORT, we first measured the concentrations of serum ACTH and CORT. Our results showed that the levels of serum ACTH in the 8- and 16-dose treatment groups increased (P < 0.05 and P < 0.001) from days 1 to 21 post vaccination compared to the control, and they peaked at day 21 post vaccination. In the 4-dose treatment group, the levels of serum ACTH were increased from days 7 to 21 post vaccination (day 7, P = 0.042; day 14, P < 0.001; day 21, P < 0.003, respectively). In the 2-dose treatment group (a dose that is routinely used) of vaccine group, the ACTH levels were increased (P < 0.003) from days 14 to 21 post vaccination (Figure 2A). Compared to the 2-dose group, the concentrations of ACTH in the 16-dose group were elevated (P < 0.001) from days 1 to 21 post vaccination and that in the 4- and 8-dose treatment groups were higher (P < 0.01) at day 14 post vaccination.

Figure 2.

Figure 2

Open in a new tab

Effect of vaccination-induced stress on serum (A) ACTH and (B) CORT concentrations in broilers at 1, 7, 14, and 21 D post vaccination. Each experiment includes NC group (non-vaccination group, control) and vaccinated groups (groups which were vaccinated with 2, 4, 8, and 16 doses of ND vaccine by nose-drop on day 13 of age, respectively). Values represent mean ± SEM. *P < 0.05, **P < 0.01 compared with NC group; #P < 0.05, ##P < 0.01 compared with routine dose (2 doses) of vaccinated group.

Our results also showed that the concentrations of serum CORT in all the vaccinated groups, except for the 2-dose group at day 21 (P > 0.05), were significantly higher (P < 0.01) at each time point post vaccination compared to the control (Figure 2B). The CORT concentrations in the 16-dose group were higher than those in the 2-dose group at day 14 (P = 0.022) and day 21 (P = 0.002).

Effects of Vaccination-Induced Stress on Growth performance

The effects of vaccination-induced stress on growth performance parameters including ADFI, ADG, and FCR at 1, 7, 14, and 21 D post vaccination are presented in Figure 3. Negative growth was observed for ADG in all treatment groups (P > 0.05) at day 1 post vaccination (Figure 3A). ADG was significantly decreased (P < 0.0001) from days 1 to 7 post vaccination in the vaccinated groups but not in the control. We calculated the ADG for the entire experimental period (from days 0 to 21); however, no significant changes were found during the late stages or the entire experimental period (P > 0.05).

Figure 3.

Figure 3

Open in a new tab

Effect of vaccination-induced stress on growth performance in broilers at 1, 7, 14, and 21 D post vaccination. (A) Average daily gain (ADG). (B) Average daily feed intake (ADFI). (C) Feed convertion ratio (FCR). Each experiment includes NC group (non-vaccination group, control) and vaccinated groups (groups which were vaccinated with 2, 4, 8, and 16 doses of ND vaccine by nose-drop on day 13 of age, respectively). Values represent mean ± SEM. *P < 0.05, **P < 0.01 compared with NC group; #P < 0.05, ##P < 0.01 compared with routine dose (2 doses) of vaccinated group.

ADFI decreased and FCR increased (P < 0.0001) from days 0 to 7 post vaccination in all the vaccinated groups compared to the controls (Figures 3B and 3C). No differences (P > 0.05) were observed from days 7 to 21, except that 2-dose group showed decreased FCR (P = 0.041), whereas the 4-, 8-, and 16-dose groups showed that increased ADFI and FCR (P ≤ 0.038 and P ≤ 0.041, respectively) compared to the 2-dose group. We also calculated ADFI and FCR for the entire experimental period (from days 0 to 21). There was no difference between the vaccinated groups and the control group (P > 0.05), except that the 2-dose group showed decreased FCR (P = 0.006), whereas the higher dose groups showed increased ADFI and FCR (P ≤ 0.043 and P ≤ 0.006, respectively) as compared with the 2-dose group.

Effects of Vaccination-Induced Stress on the Relative Weights of Lymphoid Organs

The effects of vaccination-induced stress on the relative weights of the lymphoid organs including the spleen, thymus, and bursa of Fabricius to the body weights of the broilers at 1, 7, 14, and 21 days post vaccination are presented in Figures 4A–4C, respectively. Generally speaking, there was no difference (P > 0.05) among the inoculated groups in the relative weights of the lymphoid organs as compared with the controls; however, the bursa of Fabricius index increased at day 14 (P < 0.05) and day 21 (P > 0.05) post vaccination in the 4-, 8-, 16-dose groups compared to the control and 2-dose group.

Figure 4.

Figure 4

Open in a new tab

Effect of vaccination-induced stress on the relative weights of lymphoid organs to the body weights of broilers at 1, 7, 14, and 21 D post vaccination. (A) Spleen index, (B) thymus index, (C) bursal index. Each experiment includes NC group (non-vaccination group, control) and vaccinated groups (groups which were vaccinated with 2, 4, 8, and 16 doses of ND vaccine by nose-drop on day 13 of age, respectively). Values represent mean ± SEM. *P < 0.05, **P < 0.01 compared with NC group; #P < 0.05, ##P < 0.01 compared with routine dose (2 doses) of vaccinated group.

Effects of Vaccination-Induced Stress on Apoptosis in the Spleen

We observed vaccination-induced apoptosis in the spleen lymphocytes, which was detected by flow cytometry, suggesting a stress responses induced by the vaccine (Figure 5A). The flow cytometry results were quantitated as indicated in Figure 5B. The results indicated that the total number of apoptotic cells (early apoptotic cells + late apoptotic cells) significantly increased (P < 0.01) in each vaccination group from days 1 to 21 post vaccination and the number of apoptotic cells in the highest dose group (16 doses) was significantly greater (P ≤ 0.012) than that in the 2-dose group from days 1 to 21 post vaccination.

Figure 5.

Figure 5

Open in a new tab

Effects of vaccination-induced stress on apoptosis in the chicken spleen lymphocyte at 1, 7, 14, and 21 D post vaccination. (A) Representative flow cytometric diagram of apoptosis analysis. (B) Changes of the percentages of Annexin V positive cells in the spleen. Each experiment includes NC group (non-vaccination group, control) and vaccinated groups (groups which were vaccinated with 2, 4, 8, and 16 doses of ND vaccine by nose-drop on day 13 of age, respectively). Values represent mean ± SEM. *P < 0.05, **P < 0.01 compared with NC group; #P < 0.05, ##P < 0.01 compared with routine dose (2 doses) of vaccinated group.

Effects of Vaccination-Induced Stress on Apoptosis-Related Genes in the Spleen

The results showed that the level of Bcl-2 mRNA was elevated from days 1 to 7 post vaccination and significantly decreased from days 14 to 21 (P ≤ 0.008) in all the vaccinated groups (Figure 6A). The levels of BAX mRNA were elevated at day 1 (P ≤ 0.045), day 7 (P ≤ 0.033), and day 14 (P ≤ 0.007) compared with the control, and then decreased at day 21 post vaccination (P > 0.05) except for the 16-dose group (P = 0.041) (Figure 6B).

Figure 6.

Figure 6

Open in a new tab

Effects of vaccination-induced stress on mRNA expression of apoptosis-related genes in the chicken spleen lymphocytes. (A) Expression of Bcl-2 mRNA. (B) Expression of Bax mRNA. (C) Ratio of Bcl-2 to Bax. (D) Expression of caspase-9 mRNA. (E) Expression of caspase-3 mRNA. Values represent mean ± SEM. *P < 0.05, **P < 0.01 compared with NC group; #P < 0.05, ##P < 0.01 compared with routine dose (2 doses) of vaccinated group.

It has been demonstrated that the ratio of Bcl-2 to BAX may be more important than a single promoter in determining apoptosis (Oltvai et al., 1993). Although the mRNA expressions of both the anti-apoptotic gene Bcl-2 and the pro-apoptotic gene BAX were upregulated or downregulated at different stages, we found that the ratio of Bcl-2 to BAX was lower in the immune stress groups than in the control at each time point post vaccination (P ≤ 0.001) (Figure 6C).

We also detected the gene expression of caspase-3 and -9 using real-time PCR. The mRNA levels of caspase-3 and -9 were higher (P ≤ 0.024) in the immune stress groups from days 1 to 21 post vaccination than in the control (Figures 6D and 6E). The results also showed that the expression of caspase-9 mRNA was higher (P ≤ 0.024) in all the higher dose groups than in the 2-dose group at day 14 post vaccination.

Effects of Vaccination-Induced Stress on the Activities of Caspase-3 and -9

To determine whether the enzyme activities of caspase-3 and -9 were activated, we used colorimetric caspase-3 and -9 assay kits. Our results demonstrated that the activities of caspase-3 (P ≤ 0.048) and caspase-9 (P ≤ 0.025) were activated in all the vaccinated groups from days 1 to 21 post vaccination, as compared with the control (Figures 7A and 7B), which was consistent with the real-time PCR transcripts data. The caspase-3 activities in 4-, 8- and 16-dose groups were higher (P ≤ 0.005) than that in the 2-dose group at day 1 post vaccination. The capsase-3 activity was also elevated in the 16-dose group at day 7 (P = 0.013) and day 21 (P = 0.003) post vaccination compared to the 2-dose group.

Figure 7.

Figure 7

Open in a new tab

Effects of vaccination-induced stress on the activities of (A) caspase-9 and (B) caspase-3 in the chicken spleen lymphocytes. Values represent mean ± SEM. *P < 0.05, **P < 0.01 compared with NC group; #P < 0.05, ##P < 0.01 compared with routine dose (2 doses) of vaccinated group.

Discussion

Newcastle disease, caused by virulent NDV, remains an important issue for poultry production worldwide. Currently, vaccines are still the most accepted and effective way to prevent and control the occurrence of ND (Gallili and Ben-Nathan, 1998, Cornax et al., 2012). The live LaSota strain vaccine is most commonly used against NDV in China. The results of our studies have shown that the serum antibody titers increased significantly in the vaccinated groups compared to the control (Figure 1). The antibody titers gradually rose and reached the highest level in the vaccinated groups on day 14, and then they decreased at day 21 indicating an effective immune response to the ND vaccination. We also observed that the levels of maternal antibodies against NDV decreased in a time-dependent manner in the non-vaccinated control, and they dropped to 3 log2 on day 21. These low antibody levels indicated that unvaccinated broiler chickens could be susceptible to NDV infection in the field. Farmers usually inoculate chickens with large doses of vaccines at high frequencies (Yang et al., 2011, Feng et al., 2012). It is generally believed that this dosing method more effectively protects broilers from infection because it is thought that the greater the dose of the vaccine, the greater the production of antibodies. However, our experiment showed that the antibody levels were almost the same among the different treatment groups, which differed by the number of vaccine doses the chickens received. Therefore, it is unnecessary to inoculate poultry with higher doses of vaccine against NDV infection; the conventional 2-dose inoculation method is sufficient.

Inoculating large doses of vaccine is thought to hyperimmunize them in modern poultry vaccination programs (Qureshi et al., 1998). Although chicks will receive antibodies from their mother, overimmunization will result in immunological stress for the hens. Immunological stress, as well as other forms of stress, will directly or indirectly activate the HPA axis (Koolhaas et al., 1999), contributing to release of ACTH, which stimulates adrenals to secret and release glucocorticoids, including CORT, into peripheral circulation (Webster Marketon and Glaser, 2008, Lerch et al., 2017). Various studies have shown that serum ACTH and CORT levels significantly increase due to immune stress induced by LPS (Dorshkind and Horseman, 2001, Dunn et al., 2004, Li et al., 2017), and the elevated levels of serum ACTH and CORT in these studies are consistent with those observed in our experiments. High levels of ACTH and CORT over a long period of time indicate a long-term presence of stress, which affects growth performance and induces apoptotic effects in spleen lymphocytes as observed in our experiment.

Numerous studies have shown that immune stress decreases the growth performance of broiler chickens (Virden et al., 2007, Yang et al., 2011, Feng et al., 2012, Wang et al., 2015, Mehaisen et al., 2017). Our results also showed that the decreased ADG and increased ADFI led to an increase in the FCR in the early post vaccination stages of the vaccinated groups compared to those of the control, but no significant changes were found in the late stages or in the entire post vaccination experimental period (from days 0 to 21). Interestingly, negative weight was found for the ADG in the vaccinated groups and control group at day 1 post vaccination, which may be due to the stress caused by capture. Even though the ADG and ADFI did not remarkably change from days 0 to 21 in the 2-dose group compared to the control, the FCR significantly decreased. Moreover, the FCR in all the higher dose groups (4, 8, and 16 doses) was higher than that in the 2-dose group in the late stages and in the entire post vaccination experimental period, indicating that the vaccine should be administered at appropriate levels (Wang et al., 2015). Our results have shown that administering 2 doses of live LaSota ND vaccine could elevate feed utilization while concomitantly improving growth performance.

Generally speaking, no significant difference in the lymphoid organ index was found among the vaccinated groups, which is consistent with the report that the lymphoid organs index is not affected by NDV immunization (Wang et al., 2015). However, our results showed that the bursal index in the higher dose groups (4, 8, and 16 doses) increased at day 14 (P < 0.01) and day 21 (P > 0.05) post vaccination compared to the control and the 2-dose group. The slight differences in our experimental results may be due to the discordance in experimental conditions, vaccine doses, and time points. In addition, the hypertrophied bursa in the higher dose groups indicated greater activity of this organ, which is a vital lymphoid organ involved in the production of antigens (Li et al., 2015).

In the lymphocyte life cycle, T and B cells numbers will be reduced through apoptosis at different stages of ontological development of the immune system to avoid the accumulation of the potential autoimmunity. However, apoptosis induced by external factors, such as vaccination-induced stress, would cause adverse responses that affect growth performance. It has been shown that stress can induce high levels of glucocorticoid, which triggers the apoptosis of pre-B cells, resulting in the reduction of the number of B lymphocytes and suppressed immunity (McGregor et al., 2016). It is reported that stress hormones alter the absolute number and relative proportion of blood leukocytes (Redwine et al., 2004, Viswanathan and Dhabhar, 2005, Jiang et al., 2017). The available evidence suggests that T and B cells, monocytes, neutrophils, and macrophages express corticosterone receptors, whereas T and B cells, monocytes, macrophages, and NK cells express adrenergic receptors (Glaser and Kiecolt-Glaser, 2005). Corticosterone administration reduces the number of lymphocytes in chickens and changes their morphological characteristics (Shini et al., 2008, Shini and Kaiser, 2009). Stress induced by different factors such as heat stress has also been found to cause immune organ dysfunction and apoptosis in chicken spleens (Xu et al., 2017). Another report determined that the infectious bursal disease vaccine could induce apoptotic effects on the bursa of Fabricius. It showed that the apoptosis levels in the inoculated groups were significantly higher than those in the non-vaccinated broilers (Killian et al., 2017). Consistent with these studies, our flow cytometry results showed that immune stress significantly increased the percentage of apoptotic cells in chicken spleen lymphocytes. The number of apoptotic cells in the higher dose groups was significantly higher than that in the 2-dose group.

In order to explore the possible mechanism of the apoptotic phenomenon, we analyzed the mRNA expression of crucial apoptotic genes, including Bcl-2, BAX, and caspase-3 and -9 (Socha and Hrabia, 2018). The results showed that the expression levels of all the genes increased in the treatment groups compared to the control. The ratio of Bcl-2 to BAX decreased. Although the mRNA expression of caspase-3 and -9 was elevated, we further determined the enzymatic activities of these critical apoptotic enzymes using colorimetric caspase assay kits. The results confirmed that the activities of caspase-3 and -9 were activated in the immune stress groups.

Taken together, our results suggest that vaccination-induced stress upregulates stress hormones, which causes spleen lymphocyte apoptosis and subsequent immune system suppression and decreased growth performance in broilers. We also emphasize the pitfalls of overvaccination as we found that vaccine-induced titers did not increased linearly with the inoculating doses, and the normal dose number (2 doses) was adequate to generate the desired level of immunity. Therefore, an appropriate dose of ND vaccine can maintain the balance between growth performance and immunity for effectiveness of broiler chicken production.

ACKNOWLEDGMENTS

This work was supported in part by the National Key Research and Development Program of China (No. 2016YFD0501209) and Human Provincial Natural Science Foundation of China (No. 2017JJ3108). The authors declare no competing of interest.

Footnotes

This work was supported in part by the National Key Research and Development Program of China (No. 2016YFD0501209) and Hunan Provincial Natural Science Foundation of China (No. 2017JJ3108).

Contributor Information

J. Wu, Email: wujing@hunau.edu.cn.

L.X. Wen, Email: sfwlx8015@sina.com.

References

  1. Chrousos G.P., Kino T. Glucocorticoid action networks and complex psychiatric and/or somatic disorders. Stress. 2007;10:213–219. doi: 10.1080/10253890701292119. [DOI] [PubMed] [Google Scholar]
  2. Cornax I., Miller P.J., Afonso C.L. Characterization of live LaSota vaccine strain-induced protection in chickens upon early challenge with a virulent Newcastle disease virus of heterologous genotype. Avian Dis. 2012;56:464–470. doi: 10.1637/10043-122011-Reg.1. [DOI] [PubMed] [Google Scholar]
  3. Dorshkind K., Horseman N.D. Anterior pituitary hormones, stress, and immune system homeostasis. Bioessays. 2001;23:288–294. doi: 10.1002/1521-1878(200103)23:3<288::AID-BIES1039>3.0.CO;2-P. [DOI] [PubMed] [Google Scholar]
  4. Dunn A.J., Swiergiel A.H., Palamarchouk V. Brain circuits involved in corticotropin-releasing factor-norepinephrine interactions during stress. Ann. N. Y. Acad. Sci. 2004;1018:25–34. doi: 10.1196/annals.1296.003. [DOI] [PubMed] [Google Scholar]
  5. Feng Y., Yang X.J., Wang Y.B., Li W.L., Liu Y., Yin R.Q., Yao J.H. Effects of immune stress on performance parameters, intestinal enzyme activity and mRNA expression of intestinal transporters in broiler chickens. Asian-Australas J. Anim. Sci. 2012;25:701–707. doi: 10.5713/ajas.2011.11377. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Gallili G.E., Ben-Nathan D. Newcastle disease vaccines. Biotechnol. Adv. 1998;16:343–366. doi: 10.1016/s0734-9750(97)00081-5. [DOI] [PubMed] [Google Scholar]
  7. Glaser R., Kiecolt-Glaser J.K. Stress-induced immune dysfunction: implications for health. Nat. Rev. Immunol. 2005;5:243–251. doi: 10.1038/nri1571. [DOI] [PubMed] [Google Scholar]
  8. Hangalapura B.N., Kaiser M.G., Poel J.J., Parmentier H.K., Lamont S.J. Cold stress equally enhances in vivo pro-inflammatory cytokine gene expression in chicken lines divergently selected for antibody responses. Dev. Comp. Immunol. 2006;30:503–511. doi: 10.1016/j.dci.2005.07.001. [DOI] [PubMed] [Google Scholar]
  9. Jacobi S.K., Gabler N.K., Ajuwon K.M., Davis J.E., Spurlock M.E. Adipocytes, myofibers, and cytokine biology: new horizons in the regulation of growth and body composition. J. Anim. Sci. 2006;84:140–149. doi: 10.2527/2006.8413_supple140x. [DOI] [PubMed] [Google Scholar]
  10. Jiang W., Li Y., Sun J., Li L., Li J.W., Zhang C., Huang C., Yang J., Kong G.Y., Li Z.F. Spleen contributes to restraint stress induced changes in blood leukocytes distribution. Sci. Rep. 2017;7:6501. doi: 10.1038/s41598-017-06956-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Johnson R.W. Inhibition of growth by pro-inflammatory cytokines: an integrated view. J. Anim. Sci. 1997;75:1244–1255. doi: 10.2527/1997.7551244x. [DOI] [PubMed] [Google Scholar]
  12. Kaab H., Bain M.M., Eckersall P.D. Acute phase proteins and stress markers in the immediate response to a combined vaccination against Newcastle disease and infectious bronchitis viruses in specific pathogen free (SPF) layer chicks. Poult. Sci. 2018;97:463–469. doi: 10.3382/ps/pex340. [DOI] [PubMed] [Google Scholar]
  13. Killian M.P., Boviez J.D., Gambarotta M., Lombardo D.M. Induction of apoptosis in the bursa of Fabricius by vaccination against Gumboro disease. Avian Pathol. 2017;46:526–534. doi: 10.1080/03079457.2017.1322684. [DOI] [PubMed] [Google Scholar]
  14. Koolhaas J.M., Korte S.M., De Boer S.F., Van Der Vegt B.J., Van Reenen C.G., Hopster H., De Jong I.C., Ruis M.A., Blokhuis H.J. Coping styles in animals: current status in behavior and stress-physiology. Neurosci. Biobehav. Rev. 1999;23:925–935. doi: 10.1016/s0149-7634(99)00026-3. [DOI] [PubMed] [Google Scholar]
  15. Lerch J.K., Alexander J.K., Madalena K.M., Motti D., Quach T., Dhamija A., Zha A., Gensel J.C., Webster Marketon J., Lemmon V.P., Bixby J.L., Popovich P.G. Stress increases peripheral axon growth and regeneration through glucocorticoid receptor-dependent transcriptional programs. eNeuro. 2017;4:1–19. doi: 10.1523/ENEURO.0246-17.2017. [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Li Y., Zhang H., Chen Y.P., Yang M.X., Zhang L.L., Lu Z.X., Zhou Y.M., Wang T. Bacillus amyloliquefaciens supplementation alleviates immunological stress in lipopolysaccharide-challenged broilers at early age. Poult. Sci. 2015;94:1504–1511. doi: 10.3382/ps/pev124. [DOI] [PubMed] [Google Scholar]
  17. Li K., Zhang P., Shi B., Su J., Yue Y., Tong M., Yan S. Dietary Artemisia ordosica extract alleviating immune stress in broilers exposed to lipopolysaccharide. Ital. J. Anim. Sci. 2017;16:301–307. [Google Scholar]
  18. McGregor B.A., Murphy K.M., Albano D.L., Ceballos R.M. Stress, cortisol, and B lymphocytes: a novel approach to understanding academic stress and immune function. Stress. 2016;19:185–191. doi: 10.3109/10253890.2015.1127913. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Mehaisen G.M., Eshak M.G., Elkaiaty A.M., Atta A.M., Mashaly M.M., Abass A.O. Comprehensive growth performance, immune function, plasma biochemistry, gene expressions and cell death morphology responses to a daily corticosterone injection course in broiler chickens. PLoS One. 2017;12:e0172684. doi: 10.1371/journal.pone.0172684. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. NRC . Natl. Acad. Press; Washington D.C: 1994. Nutrient Requirements of Poultry. 9th rev. ed. [Google Scholar]
  21. Oltvai Z.N., Milliman C.L., Korsmeyer S.J. Bcl-2 heterodimerizes in vivo with a conserved homolog, Bax, that accelerates programmed cell death. Cell. 1993;74:609–619. doi: 10.1016/0092-8674(93)90509-o. [DOI] [PubMed] [Google Scholar]
  22. Qureshi M.A., Hussain I., Heggen C.L. Understanding immunology in disease development and control. Poult. Sci. 1998;77:1126–1129. doi: 10.1093/ps/77.8.1126. [DOI] [PubMed] [Google Scholar]
  23. Redwine L., Mills P.J., Sada M., Dimsdale J., Patterson T., Grant I. Differential immune cell chemotaxis responses to acute psychological stress in Alzheimer caregivers compared to non-caregiver controls. Psychosom. Med. 2004;66:770–775. doi: 10.1097/01.psy.0000138118.62018.87. [DOI] [PubMed] [Google Scholar]
  24. Shini S., Huff G.R., Shini A., Kaiser P. Understanding stress-induced immunosuppression: exploration of cytokine and chemokine gene profiles in chicken peripheral leukocytes. Poult. Sci. 2010;89:841–851. doi: 10.3382/ps.2009-00483. [DOI] [PubMed] [Google Scholar]
  25. Shini S., Kaiser P. Effects of stress, mimicked by administration of corticosterone in drinking water, on the expression of chicken cytokine and chemokine genes in lymphocytes. Stress. 2009;12:388–399. doi: 10.1080/10253890802526894. [DOI] [PubMed] [Google Scholar]
  26. Shini S., Kaiser P., Shini A., Bryden W.L. Differential alterations in ultrastructural morphology of chicken heterophils and lymphocytes induced by corticosterone and lipopolysaccharide. Vet. Immunol. Immunopathol. 2008;122:83–93. doi: 10.1016/j.vetimm.2007.10.009. [DOI] [PubMed] [Google Scholar]
  27. Socha J.K., Hrabia A. Alterations in apoptotic markers and egg-specific protein gene expression in the chicken oviduct during pause in laying induced by tamoxifen. Theriogenology. 2018;105:126–134. doi: 10.1016/j.theriogenology.2017.09.024. [DOI] [PubMed] [Google Scholar]
  28. Takahashia K., Ohtaa N., Akibaa Y. Influences of dietary methionine and cysteine on metabolic responses to immunological stress by Escherichia coli lipopolysaccharide injection, and mitogenic response in broiler chickens. Brit. J. Nutr. 1997;78:815–821. doi: 10.1079/bjn19970197. [DOI] [PubMed] [Google Scholar]
  29. Virden W., Lilburn M., Thaxton J., Corzo A., Hoehler D., Kidd M. The effect of corticosterone-induced stress on amino acid digestibility in Ross broilers. Poult. Sci. 2007;86:338–342. doi: 10.1093/ps/86.2.338. [DOI] [PubMed] [Google Scholar]
  30. Viswanathan K., Dhabhar F.S. Stress-induced enhancement of leukocyte trafficking into sites of surgery or immune activation. Proc. Natl. Acad. Sci. USA. 2005;102:5808–5813. doi: 10.1073/pnas.0501650102. [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Wang X., Zhou Q., Shen J., Yao J., Yang X. Effect of difference doses of Newcastle disease vaccine immunization on growth performance, plasma variables and immune response of broilers. J. Anim. Sci. Biotechnol. 2015;6:20. doi: 10.1186/s40104-015-0019-y. [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Webster Marketon J.I., Glaser R. Stress hormones and immune function. Cell Immunol. 2008;252:16–26. doi: 10.1016/j.cellimm.2007.09.006. [DOI] [PubMed] [Google Scholar]
  33. Wilkinson K.G., Tee E., Tomkins R.B., Hepworth G., Premier R. Effect of heating and aging of poultry litter on the persistence of enteric bacteria. Poult. Sci. 2011;90:10–18. doi: 10.3382/ps.2010-01023. [DOI] [PubMed] [Google Scholar]
  34. Xu D., Li B., Cao N., Li W., Tian Y., Huang Y. The protective effects of polysaccharide of Koidz (PAMK) on the chicken spleen under heat stress via antagonizing apoptosis and restoring the immune function. Oncotarget. 2017;8:70394–70405. doi: 10.18632/oncotarget.19709. [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Yang X.J., Li W.L., Feng Y., Yao J.H. Effects of immune stress on growth performance, immunity, and cecal microflora in chickens. Poul. Sci. 2011;90:2740–2746. doi: 10.3382/ps.2011-01591. [DOI] [PubMed] [Google Scholar]

Articles from Poultry Science are provided here courtesy of Elsevier

RESOURCES