Key resources table.
| Reagent type (species) or resource |
Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Gene (Gallus gallus) | Hmga1 | UCSC genome browser | NM_204369.1 | |
| Strain, strain background (Gallus gallus) |
G. gallus | Sun State Ranch (Monrovia, CA, USA) | ||
| Antibody | Mouse IgG1 anti-Pax7 | Developmental Studies Hybridoma Bank | RRID:AB_528428 | 1:10 |
| Antibody | Rabbit anti-Laminin | Sigma-Aldrich | RRID:AB_477163 | 1:1000 on sections |
| Antibody | Mouse IgM anti-HNK1 | Developmental Studies Hybridoma Bank | RRID:AB_2314644 | 1:5 |
| Antibody | Rabbit anti-RFP | MBL | RRID:AB_591279 | 1:500 |
| Antibody | Rabbit anti-Slug (C19G7) | Cell Signaling | RRID:AB_2239535 | 1:200 |
| Antibody | Goat IgG anti-GFP | Rockland | RRID:AB_218182 | 1:500 |
| Antibody | Rabbit anti-cleaved-caspase-3 | R and D systems | RRID:AB_2243952 | 1:500 on sections |
| Antibody | Mouse anti-phospho-histone H3 | Abcam | RRID:AB_443110 | 1:500 on sections |
| Recombinant DNA reagent | pCI-H2B-RFP (plasmid) | Betancur et al., 2010 | ||
| Recombinant DNA reagent | CAG > nls-Cas9-nls (plasmid) | Gandhi et al., 2017 | RRID:Addgene_99138 | |
| Recombinant DNA reagent | cU6.3>Ctrl. gRNA.f+e (plasmid) | Gandhi et al., 2017 | RRID:Addgene_99140 | |
| Recombinant DNA reagent | cU6.3>Hmga1.1. gRNA.f+e (plasmid) | This paper | Detailed in Materials and methods section ‘CRISPR-Cas9-mediated perturbations’ | |
| Recombinant DNA reagent | cU6.3>Hmga1.2. gRNA.f+e (plasmid) | This paper | Detailed in Materials and methods section ‘CRISPR-Cas9-mediated perturbations’ | |
| Recombinant DNA reagent | FoxD3-NC2:eGFP (plasmid) | Simões-Costa et al., 2012 | ||
| Recombinant DNA reagent | Tcf/Lef: H2B-GFP (plasmid) | Ferrer-Vaquer et al., 2010 | RRID:Addgene_32610 | |
| Recombinant DNA reagent | NC1-∆90β-cat (plasmid) | Hutchins and Bronner, 2018 | ||
| Recombinant DNA reagent | pCI-Pax7-IRES-H2B-RFP (plasmid) | Roellig et al., 2017 | ||
| Sequence-based reagent | Hmga1.1. gRNA | This paper | PCR primer | 5’-gCAGGAAGAAACCGGAGgta |
| Sequence-based reagent | Hmga1.2. gRNA | This paper | PCR primer | 5’-GCCAGCTCCAAAGGCAGGgt |
| Sequence-based reagent | AscI-V5-Fwd | This paper | PCR primer | 5’-ggcgcgccaccATGGCTGGTAAGCCTA |
| Sequence-based reagent | V5-Hmga1-Fwd | This paper | PCR primer | 5’-CTCCTCGGTCTCGATTCTagcgacgccggcgccaagcc |
| Sequence-based reagent | Hmga1OLP-V5-Rev | This paper | PCR primer | 5’-ggcttggcgccggcgtcgctAGAATCGAGACCGAGGAG |
| Sequence-based reagent | Hmga1-ClaI-Rev | This paper | PCR primer | 5’-ttatcgattcactgctcctcctcggatg |
| Sequence-based reagent | Hmga1.1 short guide oligo | This paper | PCR primer | 5’-GCGTAATACGACTCACTATAGGCAGGAAGAAACCGGAGGTAGTTTTAGAGCTAGAAATAGC |
| Sequence-based reagent | Hmga1.2 short guide oligo | This paper | PCR primer | 5’-GCGTAATACGACTCACTATAGGCCAGCTCCAAAGGCAGGGTGTTTTAGAGCTAGAAATAGC |
| Sequence-based reagent | Control short guide oligo | Hutchins and Bronner, 2018 | PCR primer | Detailed in Materials and methods section ‘CRISPR-Cas9-mediated perturbations’ |
| Sequence-based reagent | gRNA Primer 1 | Hutchins and Bronner, 2018 | PCR primer | Detailed in Materials and methods section ‘CRISPR-Cas9-mediated perturbations’ |
| Sequence-based reagent | gRNA Primer 2 | Hutchins and Bronner, 2018 | PCR primer | Detailed in Materials and methods section ‘CRISPR-Cas9-mediated perturbations’ |
| Sequence-based reagent | Guide-constant oligo | Hutchins and Bronner, 2018 | PCR primer | Detailed in Materials and methods section ‘CRISPR-Cas9-mediated perturbations’ |
| Commercial assay or kit | Chromium Single Cell 3’ Library and Gel Bead Kit v2 | 10X Genomics | Cat# PN-120267 | |
| Commercial assay or kit | Chromium Single Cell A Chip Kit | 10X Genomics | Cat# PN-1000009 | |
| Commercial assay or kit | Endofree maxi prep kit | Macharey Nagel | Cat# 740426.50 | |
| Commercial assay or kit | Agencourt AMPure XP beads | Beckman Coulter | Cat# A63880 | |
| Commercial assay or kit | Dynabeads MyOne SILANE | 10X Genomics | Cat# 2000048 | |
| Commercial assay or kit | SPRIselect Reagent Kit | Beckman Coulter | Cat# B23318 | |
| Commercial assay or kit | High Sensitivity DNA Kit | Agilent | Cat# 5067–4626 | |
| Commercial assay or kit | Qubit dsDNA HS Assay Kit | Thermo Fisher Scientific | Cat# Q32854 | |
| Software, algorithm | Fiji | Schindelin et al., 2012 | RRID:SCR_002285 | https://imagej.net/Fiji |
| Software, algorithm | Seurat | Butler et al., 2018 | RRID:SCR_007322 | https://satijalab.org/seurat/ |
| Software, algorithm | Inkscape | Inkscape | RRID:SCR_014479 | https://inkscape.org/ |
| Software, algorithm | Cellranger | 10X Genomics | ||
| Software, algorithm | 2100 Expert software | Agilent | RRID:SCR_014466 | |
| Other | Fluoromount-G | Southern Biotech | Cat# 0100–01 | |
| Other | DAPI | Thermo Fisher Scientific | Cat# D1306 | 1:10000 on sections |