Key resources table.
| Reagent type (species) or resource |
Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Antibody | Anti-BrdU (Mose monoclonal) | Sigma-Aldrich | B9434 | IF (1:800) |
| Antibody | Anti-MCM3 (Rabbit polyclonal) | Stillman B. lab, CSHL | clone 738 | WB (1:1000) |
| Antibody | Anti-Orc2 (Rabbit polyclonal) | Stillman B. lab, CSHL | clone 205–6 | WB (1:500) |
| Antibody | Anti-SRSF1 (Mouse monoclonal) | Krainer A. lab, CSHL | clone 96 | WB (1:1000) |
| Antibody | Anti-p53 (Mouse monoclonal) | Santa Cruz | sc-126 | WB (1:500) |
| Antibody | Anti-B’-U2 snRNP (Mouse polyclonal) | Spector lab, CSHL | clone 4G3 | WB (1:250) |
| Antibody | Anti-Chk1 (Rabbit polyclonal) | Cell Signaling | #2345 | WB (1:500) |
| Antibody | Anti-pChk1-S345 (Rabbit polyclonal) | Cell Signaling | #2348 | WB (1:500) |
| Antibody | Anti-Chk2 (Rabbit polyclonal) | Cell Signaling | #2662 | WB (1:500) |
| Antibody | Anti-pChk2-T68 (Rabbit polyclonal) | Cell Signaling | #2661 | WB (1:500) |
| Antibody | Anti-pBRCA1-S1524 (Rabbit polyclonal) | Cell Signaling | #9009 | WB (1:400) |
| Antibody | Anti-RPA32 (Rat polyclonal) | Cell Signaling | #2208 | WB (1:700), IF (1:500) |
| Antibody | Anti-γH2AX (Rabbit monoclonal) | Cell Signaling | #9718 | WB (1:700) |
| Antibody | Anti-αTubulin (Mouse monoclonal) | Sigma-Aldrich | T5168 | WB (1:5000) |
| Antibody | Anti-WTIP (Mouse polyclonal) | Sigma-Aldrich | SAB1411722 | WB (1:200) |
| Antibody | Anti-Cyclin D1 (Rabbit polyclonal) | Cell Signaling | #2922 | WB (1:500) |
| Antibody | Anti-LATS1 (Mouse monoclonal) | Santa Cruz | sc-398560 | WB (1:100) |
| Antibody | Anti-pLATS1-S909 (Rabbit polyclonal) | Cell Signaling | #9157 | WB (1:1000) |
| Antibody | Anti-YAP1 (Mouse monoclonal) | Santa Cruz | sc-376830 | WB (1:100), IF (1:50) |
| Antibody | Anti-TAZ (Mouse monoclonal) | Santa Cruz | sc-518036 | WB (1:100) |
| Antibody | Anti-CTGF (Mouse monoclonal) | Santa Cruz | sc-365970 | WB (1:100) |
| Antibody | Anti-β-Actin (Mouse monoclonal) | Santa Cruz | sc-47778 | WB (1:300) |
| Antibody | Anti-p15/PAF (Rabbit polyclonal) | Santa Cruz | sc-9996 | WB (1:200) |
| Antibody | Anti-GFP (Mouse monoclonal) | Santa Cruz | sc-67280 | WB (1:100) |
| Antibody | Anti-DDX5 (Mouse monoclonal) | Millipore | clone204, #05–580 | WB (1:200) |
| Antibody | Anti-Pol II (Mouse monoclonal) | Millipore | clone CTD4H8, #05–623 | WB (1:1000), ChIP (5 μg/experiment) |
| Antibody | Anti-53BP1 (Rabbit polyclonal) | Cell Signaling | #4937 | IF (1:300) |
| Antibody | Anti-DDX5 (Rabbit polyclonal) | BETHYL | A300-523A | ChIP (5 μg/experiment) |
| Antibody | Anti-BrdU (CldU) (Rat monoclonal) | Bio-Rad | OBT0030G, Clone BU1/75 (ICR1) | DNA fiber assay (1:200) |
| Antibody | Anti-BrdU (IdU) (Mouse monoclonal) | BD | #347580, clone B44 | DNA fiber assay (1:200) |
| Transfected construct | pT3.5 Caggs-FLAG-hCas9 | This paper | Construct to express Cas9 for making KO cell lines | |
| Transfected construct | pCR4-TOPO-U6-gRNA | This paper | Backbone of the construct to express gRNAs for making KO cell lines | |
| Transfected construct | pcDNA-PB7 | This paper | Construct to express PiggyBac transposase for making KO cell lines | |
| Transfected construct | pPBSB-CG-Luc-GFP-Puro | This paper | Construct to express the puromycin resistent gene for making KO cell lines | |
| Transfected construct (human) | pTRIPZ-EGFP:WTIP | Addgene Ibar et al., 2018 | #66953 | Lentiviral vector for Tet-inducible EGFP:WTIP fusion protein expression |
| Commercial assay or kit | FITC BrdU Flow Kit (RUO) | BD Pharmingen | #559619 | |
| Commercial assay or kit | ChIP-IT High Sensitivity kit | Active Motif | #53040 | |
| Commercial assay or kit | CometAssay Kit | Trevigen | 4250–050 K | |
| Commercial assay or kit | Dual-Luciferase Reporter Assay System | Promega | E1910 | |
| Commercial assay or kit | Click-iT Nascent RNA Capture Kit | Invitrogen | C10365 | |
| Commercial assay or kit | FiberPrep (DNA Extraction Kit) | Genomic vision | EXTR-001 | |
| Cell line (H. sapiens) | HCT116 | ATCC | CCL-247 | |
| Cell line (H. sapiens) | BT20 | ATCC | HTB-19 | |
| Cell line (H. sapiens) | U2OS | ATCC | HTB-96 | |
| Cell line (H. sapiens) | HeLa | ATCC | CCL-2 | |
| Cell line (H. sapiens) | HCT116 p53 -/- | Vogelstein B. lab, Johns Hopkins Uni. | ||
| Chemical compound, drug | Thymidine | Sigma-Aldrich | T9250 | |
| Chemical compound, drug | Nocodazole | Sigma-Aldrich | M1404 | |
| Chemical compound, drug | Doxorubicin hydrochloride | Sigma-Aldrich | D1515 | |
| Chemical compound, drug | Etoposide | Sigma-Aldrich | E1383 | |
| Chemical compound, drug | Hydroxyurea | Sigma-Aldrich | H8627 | |
| Chemical compound, drug | Nutlin-3 | Sigma-Aldrich | N6287 | |
| Chemical compound, drug | Actinomycin D | Sigma-Aldrich | A9415 | |
| Chemical compound, drug | Doxycyline Hyclate | Sigma-Aldrich | D9891 | |
| Chemical compound, drug | BrdU | Sigma-Aldrich | B9285 | |
| Chemical compound, drug | EdU | Invitrogen | A10044 | |
| Chemical compound, drug | CldU | Sigma-Aldrich | C6891 | |
| Chemical compound, drug | IdU | MP Biomedicals | SKU02100357.2 | |
| Chemical compound, drug | Alexa Fluor 488 Azide | Invitrogen | A10266 | |
| Sequence-based reagent | SUNO1-5'gRNA | This paper | gRNA for SCRISPR KO | CCTAACCTAGATCTCCC |
| Sequence-based reagent | SUNO1-3'gRNA | This paper | gRNA for SCRISPR KO | AGGGTGGACAGGGATGC |
| Sequence-based reagent | SUNO1-F | This paper | qPCR primers | CACCAACAGACGTGAGTTCGA |
| Sequence-based reagent | SUNO1-R | This paper | qPCR primers | AGAACACTGCGAGGCTCACA |
| Sequence-based reagent | siNC | This paper | control siRNA | targeted sequence: UUCUCCGAACGUGUCACGU |
| Sequence-based reagent | siSUNO1-a | This paper | SUNO1-specific siRNA | targeted sequence: GCACGUGGUAAUACAUAAU |
| Sequence-based reagent | siSUNO1-b | This paper | SUNO1-specific siRNA | targeted sequence: GAGGAAUGCUGAUCUAGAA |
| Sequence-based reagent | siSUNO1-c | This paper | SUNO1-specific siRNA | targeted sequence: GGCGUGAUUUAGAUGGAAA |
| Transfected construct (Human) | siRNA to WTIP (SMARTpool) | Dharmacon | L-023639-02-0005 |