Table 1.
Table of the top 10 putative novel equine miRNAs detected in this dataset ranked according to decreasing probability of the novel miRNA to be a true positive (represented by the miRDeep2 score; Supplementary Table S1). Additionally, the number of mismatches and the length of the putative novel miRNAs in nucleotides, as well as the mature consensus sequences, are indicated.
| Provisional Name of Novel miRNA | Human Homologous miRNA ID | Number of Mismatches between Human/Equine miRNA | Consensus Mature Sequence |
|---|---|---|---|
| chr6_31290 | hsa-let-7a-5p | 0/21 | ugagguaguaguuugugcuguu |
| chr20_16763 | hsa-miR-30e-3p | 2/20 | uguaaacacccgacuggaagcc |
| chrX_37753 | - | - | agagguaaaaaauugauuugacu |
| chr6_30538 | hsa-miR-26b-5p | 0/21 | uucaaguaauucaggauagguu |
| chr6_31452 | hsa-miR-375-5p | 0/22 | uuuguucguucggcucgcguga |
| chr24_19655 | hsa-miR-203a-3p | 0/22 | gugaaauguuuaggaccacuaga |
| chr2_24882 | hsa-miR-320a-3p | 0/22 | aaaagcuggguugagagggcga |
| NW_019643269.1_38788 | - | - | gccgaucgaaagggagucgg |
| chr13_5604 | hsa-miR-339-5p | 0/22 | ucccuguccuccaggagcucacu |
| chr7_33613 | hsa-miR-181c-5p | 0/22 | aacauucaaccugucggugagu |