Table 6.

Differentially expressed putative novel equine miRNAs in any of the three group comparisons. The miRDeep2 given provisional miRNA ID, the consensus sequence of the novel equine miRNA, as well as a potential human homologous miRNA ID are listed.

Provisional miRNA ID	Consensus Sequence	Homologous miRNA	Percent Identity
eca-miR-NW_019643269.1_38788	gccgaucgaaagggagucgg	hsa-miR-5006-3p	93.8% (identical seed)
eca-miR-chr15_8716	accuggggaucugaggagg	hsa-miR-6852-5p	93.8% (identical seed)
eca-miR-chr7_32350	aucccaccacugccacca	hsa-miR-1260a	94.4% (identical seed)
eca-miR-chrX_37117	uuccccggcaucuccucca	hsa-miR-6763-3p	42.1% (identical seed)
eca-miR-chr6_31338	uccccggcuccuccacca	hsa-miR-4707-5p	38.9% (identical seed)
eca-miR-chrX_37753	agagguaaaaaauugauuugacu	bta-miR-6119-5p	100% (identical seed)