Key Resources Table.
| Reagent or Resource | Source | Identifier |
|---|---|---|
| Bacterial and Virus Strains | ||
| Escherichia coli LACR II rna-, rnb- (E. coli LOBSTR RNase I and II knock-out strain) | (Andersen et al., 2013); and to be published | |
| Chemicals, Peptides, and Recombinant Proteins | ||
| pVS11_His10_HRV3C_Ec_RNAP (E. coli RNAP co-expression plasmid for α-, β-, C-terminally His10- tagged β-, and ω-subunits) | (Twist et al., 2011) | |
| pACYC_Duet1_rpoZ (E. coli RNAP ω-subunit expression plasmid) | (Twist et al., 2011) | |
| pSKB2_His6_HRV3C_Ec_GreB (E. coli GreB with cleavable N-terminal His6-tag | This work | |
| Deposited Data | ||
| E. coli Backtracked complex (non-swiveled) | This work | PDB ID: VVVV |
| Backtracked complex density map (non-swiveled) | This work | EMD-VVVV |
| E. coli Backtracked complex (swiveled) | This work | PDB ID: WWWW |
| Backtracked complex density map (swiveled) | This work | EMD-WWWW |
| E. coli Pre-cleavage complex | This work | PDB ID: XXXX |
| Pre-cleavage complex density map | This work | EMD-XXXX |
| E. coli Post-cleavage complex | This work | PDB ID: YYYY |
| Post-cleavage complex density map | This work | EMD-YYYY |
| E. coli Substrate-bound complex | This work | PDB ID: ZZZZ |
| Substrate-bound complex density map | This work | EMD-ZZZZ |
| Experimental Models: Organisms/Strains | ||
| Escherichia coli | ||
| Oligonucleotides | ||
| Template DNA (used in the backtracked and pre-cleavage complexes): 3’- CGTGTAGTGGGTAAGGTCCGCTACACGTACCGAT CGACG-5’ |
This work | |
| Non-template DNA (used in the backtracked and pre-cleavage complexes): 5’- GCACATCACCCATTCAGAAGCTAAGGCATGGCTA GCTGC-3’ |
This work | |
| RNA (used in the backtracked and pre-cleavage complexes): 5’-UCAGGCGAU**UUUU-3’ |
This work | |
| Template DNA (used in the post-cleavage and substrate-bound complexes): 3’- CCAGTCATGCAGGGCTACACACGACCTTCTCTAA GTCTC-5’ |
This work | |
| Non-template DNA (used in the post-cleavage and substrate-bound complexes): 5’- GGTCAGTACGTCCCGTCGATCTTCGGAAGAGATT CAGAG-3’ |
This work | |
| RNA (used in the post-cleavage complex): 5’- UCAGGCGAUGUGUG -3’ |
This work | |
| RNA (used in the substrate-bound complex): 5’-UCAGGCGAUGUGUG** -3’ |
This work | |
| Software and Algorithms | ||
| Relion v2.1 | (Scheres, 2012) | https://www2.mrc-lmb.cam.ac.uk/relion/index.php/Main_Page |
| CryoSPARC v0.6.5 | (Punjani et al., 2017) | https://cryosparc.com |
| Motioncor2 | (Zheng et al., 2016) | http://msg.ucsf.edu/em/software/motioncor2.html |
| Gctf | (Zhang, 2016) | https://www.mrc-lmb.cam.ac.uk/kzhang/Gctf/ |
| Gautomatch | https://www.mrc-lmb.cam.ac.uk/kzhang/Gautomatch/ | |
| EMAN v2.2 | (Tang et al., 2007) | http://blake.bcm.edu/emanwiki/EMAN2 |
| CCP4 suite | (Winn et al., 2011) | http://www.ccp4.ac.uk/ |
| Phenix suite | (Adams et al., 2010) | https://www.phenix-online.org/ |
| COOT v0.8.3 | (Emsley and Cowtan, 2004) | https://www2.mrc-lmb.cam.ac.uk/personal/pemsley/coot/ |
| PyMOL v1.6 | (Schrodinger, LLC, 2015) | https://pymol.org/2/ |
| UCSF Chimera v1.11.2 | (Pettersen et al., 2004) | https://www.cgl.ucsf.edu/chimera/download.html |
| LocScale density scaling (sharpening) procedure | (Jakobi et al., 2017) | https://git.embl.de/jakobi/LocScale |
*
indicates phosphorothioate modification
**
indicates terminal 3’-deoxyguanosine-5’-monophosphate (3’-dGMP)