REAGENT or RESOURCE	SOURCE	IDENTIFIER
Antibodies
Anti-phospho-SMAD2 (Western)	Cell Signaling Technology	Cat# 3108; RRID: AB_490941
Anti-SMAD2/3 (IF and Western)	BD Biosciences	Cat# 610843; RRID: AB_398162
Anti-phospho-SMAD1/5 (Western)	Cell Signaling Technology	Cat# 13820; RRID: AB_2493181
Anti-SMAD1 (Western)	Invitrogen	Cat# 38-5400; RRID: AB_2533373
Anti-phospho-SMAD3 (Western)	Cell Signaling Technology	Cat# 9520; RRID: AB_2193207
Anti-SMAD3 (Western)	Abcam	Cat# 40854; RRID: AB_777979
Anti-ACVR1B (Western)	LSBio	Cat# LS-B2695
Anti-ACVR2B (Western)	Aviva Systems Biology	Cat# ARP45041; RRID: AB_10644782
Anti-BMPR2 (Western)	BD Biosciences	Cat# 612292; RRID: AB_399609
Anti-UBAP1 (Western)	Proteintech	Cat# 12385-1; RRID: AB_2211886
Anti-SMURF1 (Western)	Santa Cruz	Cat# sc-25510; RRID: AB_2302385
Anti-SMURF2 (Western)	Cell Signaling Technology	Cat# 12024
Anti-TGFBR1 (Western)	Santa Cruz	Cat# sc-398 RRID: AB_632493
Anti-TGFBR2 (Western)	Santa Cruz	Cat# sc-17792; RRID: AB_628349
Anti-ACTA2 (Western)	Sigma Aldrich	Cat# A5228; RRID: AB_262054
Anti-GRB2 (Western)	BD Biosciences	Cat# 610112; RRID: AB_397518
Anti-MCM6 (Western)	Santa Cruz	Cat# sc-9843; RRID: AB_2142543
Anti-Tubulin (Western)	Abcam	Cat# ab6160; RRID: AB_305328
Anti-Actin (Western)	Sigma Aldrich	Cat# A3853; RRID AB_262137
Anti-TJP1 (IF)	Invitrogen	Cat# 61-7300; RRID: AB_2533938
Anti-CDH1 (IF)	BD Biosciences	Cat# 610181; RRID: AB_397580
Anti-HA (IF)	Sigma Aldrich	Cat# 11867423001; RRID: AB_10094468
Anti-EEA1 (IF)	BD Biosciences	Cat# 610456; RRID: AB_397829
Anti-HGS (IF)	Enzo Life Sciences	Cat# ALX-804-382; RRID: AB_2118912
Anti-Rabbit Alexa Fluor 488 (IF)	ThermoFisher Scientific	Cat# A-21206; RRID: AB_2535792
Anti-Mouse Alexa Fluor 488 (IF)	ThermoFisher Scientific	Cat# A-11001; RRID: AB_2534069
Anti-Mouse Alexa Fluor 594 (IF)	ThermoFisher Scientific	Cat# A-21203; RRID: AB_2535789
Anti-Rabbit Alexa Fluor 594 (IF)	ThermoFisher Scientific	Cat# A-21244; RRID: AB_10562581
Chemicals, Peptides, and Recombinant Proteins
SB-431542	Tocris	Cat# 1614
Rhodamine-Phalloidin	ThermoFisher Scientific	Cat# R415
Human recombinant TGFβ1	Peprotech	Cat# 100-21
Human recombinant BMP4	Peprotech	Cat# 120-05ET
Human recombinant Activin A	Peprotech	Cat# 120-14
cOmplete, EDTA-free Protease Inhibitor Cocktail	Sigma Aldrich	Cat# 000000011873580001
Bafilomycin A1	Merck Millipore	Cat# 196000
EZ-Link Sulfo-NHS-Biotin	ThermoFisher Scientific	Cat# 21217
Pierce NeutrAvidin Agarose	ThermoFisher Scientific	Cat# 29200
Cycloheximide	Sigma Aldrich	Cat# C7698
1D11	Gift from Lalage Wakefield (NCI, Bethesda)	N/A
13C4	Gift from Lalage Wakefield (NCI, Bethesda)	N/A
INTERFERin	Polyplus	Cat# 409-10
PowerUp SYBR Green Master Mix	ThermoFisher Scientific	Cat# A25742
TRIzol	ThermoFisher Scientific	Cat# 15596026
DAPI	Sigma Aldrich	Cat# 10236276001
Critical Commercial Assays
CellTiter-Glo Luminescent Cell Viability Assay	Promega	Cat# G7570
Experimental Models: Cell lines
HaCaT cells, human	Francis Crick Institute Cell Services	N/A
EpRas cells, mouse	Gift from Martin Oft and Hartmut Beug (IMP, Vienna)	N/A
MDA-MB-231 cells, human	ECACC/HPA culture collection	Cat# 92020424; RRID: CVCL_0062
MDA-MB-231 HA-TGFBR1 cells, human	This paper	N/A
NMuMG cells, mouse	ATCC	Cat# CRL-1636; RRID: CVCL_0075
NMuMG KO TGFBR1	This paper	N/A
Oligonucleotides
See Table S2 for oligonucleotides	N/A	N/A
See Table S2 for siRNAs	N/A	N/A
TGFBR1 guide RNA: GGTGAATGACAGTGCGGTTA	This paper	N/A
Recombinant DNA
HA-TGFBR1	Kavsak et al., 2000	N/A
pSUPER.retro.puro	OligoEngine	Cat# VEC-pRT-0002
pSpCas9(BB)-2A-GFP (PX458)	Ran et al., 2013	Addgene Cat# 48138
Software and Algorithms
FIJI (ImageJ)	https://imagej.net/Fiji/Downloads	N/A
MATLAB (Version R2016b)	https://uk.mathworks.com	N/A
FIREHOSE	https://gdac.broadinstitute.org/	N/A
FlowJo 10	FlowJo	N/A
HCS Studio Cell Analysis Software	ThermoFisher Scientific	N/A