Key Resource Table.
| REAGENT or RESOURCE | SOURCE | IDENTIFIER |
|---|---|---|
| Antibodies | ||
| Anti-Mouse CD45.1 (BV605 conjugated, clone A20) | Biolegend | Cat#110738; RRID: AB_11204076 |
| Anti-Mouse CD45.2 (PerCP conjugated, clone 104) | Biolegend | Cat#109826; RRID: AB_893349 |
| Anti-Mouse CD4 (Biotin conjugated, clone H129.19) | BD Biosciences | Cat#553649; RRID: AB_394969 |
| Anti-Mouse CD5 (Biotin conjugated, clone 53-7.3) | BD Biosciences | Cat#553019; RRID: AB_394557 |
| Anti-Mouse CD8a (Biotin conjugated, clone 53-6.7) | BD Biosciences | Cat#553029; RRID: AB_394567 |
| Anti-Mouse CD11b (Biotin conjugated, clone M1/70) | BD Biosciences | Cat#553309; RRID: AB_394773 |
| Anti-Mouse CD45R/B220 (Biotin conjugated, clone RA3-6B2) | BD Biosciences | Cat#553086; RRID: AB_394616 |
| Anti-Mouse Gr-1/Ly-6G/C (Biotin conjugated, clone RB6-8C5) | BD Biosciences | Cat#553125; RRID: AB_394641 |
| Anti-Mouse Ter119 (Biotin conjugated, clone TER-119) | BD Biosciences | Cat#553672; RRID: AB_394985 |
| Anti-Mouse c-Kit/CD117 (BV711 conjugated, clone 2B8) | Biolegend | Cat#105835; RRID: AB_2565956 |
| Anti-Mouse Sca-1 (APC-Cy7 conjugated, clone D7) | Biolegend | Cat#108126; RRID: AB_10645327 |
| Anti-Mouse CD48 (APC conjugated, clone HM48-1) | Biolegend | Cat#103411; RRID: AB_571996 |
| Anti-Mouse CD150 (PE-Cy7 conjugated, clone 12F12.2) | Biolegend | Cat#115914; RRID: AB_439797 |
| Anti-Mouse CD19 (Biotin conjugated, clone 1D3) | Biolegend | Cat#1; 553784; RRID: AB_395048 |
| Anti-Mouse Sca-1 (PB conjugated, clone D7) | Biolegend | Cat#108120; RRID: AB_493273 |
| Anti-Mouse CD16/32 (APC-CY7 conjugated, clone 93) | Biolegend | Cat#101328; RRID: AB_2104158 |
| Anti-Mouse CD41 (BV605 conjugated, clone MWReg30) | Biolegend | Cat#133921; RRID: AB_2563933 |
| Anti-Mouse CD105 (APC conjugated, clone MJ7/18) | Biolegend | Cat#120413; RRID: AB_2277915 |
| Anti-Mouse Ter119 (FITC conjugated, clone TER-119) | Biolegend | Cat#116206; RRID: AB_313707 |
| Anti-Mouse CD45R/B220 (APC conjugated, clone RA3-6B2) | Biolegend | Cat#103212; RRID: AB_312997 |
| Anti-Mouse CD19 (APC-Cy7 conjugated, clone 6D5) | Biolegend | Cat#115529; RRID: AB_830707 |
| Anti-Mouse CD11b (PB conjugated, clone M1/70) | Biolegend | Cat#101224; RRID: AB_755986 |
| Anti-Mouse Gr-1/Ly-6G/C (PE-Cy7 conjugated, clone RB6-8C5) | Biolegend | Cat#108416; RRID: AB_313381 |
| Anti-Mouse Ter119 (PE-Cy5 conjugated, clone TER-119) | Biolegend | Cat#116210; RRID: AB_313711 |
| Anti-Mouse CD8a (APC conjugated, clone 53-6.7) | Biolegend | Cat#100712; RRID: AB_312751 |
| Anti-Mouse CD4 (APC conjugated, clone GK1.5) | Biolegend | Cat#100411; RRID: AB_312696 |
| Anti-Mouse CD8a (APC-CY7 conjugated, clone YTS156.7.7) | Biolegend | Cat#126620; RRID: AB_2563951 |
| Anti-Mouse CD25 (PB conjugated, clone PC61) | Biolegend | Cat#102022; RRID:AB_493643 |
| Anti-Mouse CD44 (PE-CY7 conjugated, clone IM7) | Biolegend | Cat#103030; RRID: AB_830787 |
| Fc Block (anti-mouse CD16/32, clone 93) | Biolegend | Cat#101320; RRID: AB_1574975 |
| Streptavidin (PerCP conjugated) | Biolegend | Cat#405213 |
| Streptavidin (Pacific Blue conjugated) | ThermoFisher Scientific | Cat# S11222 |
| DAPI | BD Biosciences | Cat#564907; RRID: AB_2869624 |
| Mouse hematopoietic progenitor cell isolation cocktail | Stem Cell Technologies | 19856 |
| CD48-APC | ThermoFischer | 17-0481-82, RRID:AB_469408 |
| c-Kit-APC/Cy7 | Biolegend | 105826, RRID:AB_1626278 |
| Sca1-BV421 | Biolegend | 108133, RRID:AB_2650926 |
| CD150-PE/Cy7 | Biolegend | 115914, RRID:AB_439797 |
| Streptavidin-BV510 | Biolegend | 405234 |
| Chemicals, peptides, and recombinant proteins | ||
| Tamoxifen | Sigma | T5648; CAS: 10540-29-1 |
| Corn Oil | Sigma | C8267; CAS: 8001-30-7 |
| DAPI | BD Pharmigen | 564907 |
| Ammonium Chloride | Stem Cell Technologies | 07800 |
| SUPERase-In RNase Inhibitor | ThermoFisher | AM2694 |
| dNTP mix | ThermoFisher | 10319879 |
| ERCC RNA Spike-In Mix | ThermoFisher | 4456740 |
| Maxima H minus Reverse Transcriptase | ThermoFisher | EP0753 |
| Terra PCR Direct Polymerase Mix | Takara | 639270 |
| Agencourt AMPure XP beads | Beckman Coulter | A63881 |
| Nextera XT DNA sample preparation kit 96 samples | Illumina | FC-131-1096 |
| Triton X-100 solution | Sigma | 93443 |
| PEG 8000 solution | Sigma | P1458 |
| Phusion polymerase | ThermoFischer | F530L |
| Critical commercial assays | ||
| 10x Genomics Single Cell 3’ v3 | 10X Genomics | PN-1000268 |
| Deposited data | ||
| Sequencing data | This paper | GEO: GSE207412 |
| Pre-processed input data | This paper | https://doi.org/10.5281/zenodo.10156542 |
| Extended data figures | This paper | https://doi.org/10.5281/zenodo.10156542 |
| Extended data tables | This paper | https://doi.org/10.5281/zenodo.10156542 |
| Experimental models: Organisms/strains | ||
| Mouse: Hoxb5mKO2 | This paper | N/A |
| Mouse: Hoxb5CreERT2 | This paper | N/A |
| Oligonucleotides | ||
| See Table S7 for list of oligonucleotides and ssDNA | This paper | N/A |
| TSO 5′- AAGCAGTGGTATCAACGCAGAGTACATrGrG+G-3’ |
IDT | NA |
| Oligo-dT30VN 5′– AAGCAGTGGTATCAACGCAGAGTAC(T30)VN-3’ |
IDT | NA |
| ISPCR oligo 5′-AAGCAGTGGTATCAACGCAGAGT-3’ | IDT | NA |
| Nextera XT 96-Index kit, 384 samples | Illumina | FC-131-1002 |
| Recombinant DNA | ||
| Software and algorithms | ||
| FlowJo v10 | FlowJo,Tree Star Inc. | N/A |
| GraphPad Prism 6 software | GraphPad Software, Inc. | N/A |
| Analysis code | This paper |
https://doi.org/10.5281/zenodo.10156542 and https://github.com/Iwo-K/HSPCdynamics2022 |
| Singularity container (containing all scRNA-Seq analysis software) | This paper | https://doi.org/10.5281/zenodo.10156542 |
| Cellproject | https://github.com/Iwo-K/cellproject | NA |
| Cellranger v3.1.0 | 10X genomics | NA |