KEY RESOURCES TABLE
| REAGENT or RESOURCE | SOURCE | IDENTIFIER |
|---|---|---|
| Antibodies | ||
| NKX2.1 | Abcam | Cat# ab76013; RRID:AB_1310784 |
| RUNX2 | Cell Signaling Technology | Cat# 12556S; RRID:AB_2732805 |
| LGALS1 | Cell Signaling Technology | Cat# 13888S; RRID:AB_2798338 |
| HMGA2 | Cell Signaling Technology | Cat# 8179S; RRID:AB_11178942 |
| ZEB1 | Abcam | Cat# ab87280; RRID:AB_2040541 |
| RUNX1 | Cell Signaling Technology | Cat# 8529S; RRID:AB_10950225 |
| SFTPC | Millipore Sigma | Cat# AB3786; RRID:AB_91588 |
| SFTPB | ThermoFisher | Cat# PA5-42000; RRID:AB_2609628 |
| BATF | Sigma Aldrich | Cat# SAB4500122; RRID:AB_10745033 |
| CAV1 | Sigma Aldrich | Cat# C3237; RRID:AB_476842 |
| HOPX | Proteintech | Cat# 11419-1-AP; RRID:AB_10693525 |
| HSP90 | BD Biosciences | Cat# 610418; RRID:AB_397798 |
| RUNX3 | Abcam | Cat# ab135248; RRID:AB_2848183 |
| RFP | Rockland | Cat# 600-401-379; RRID:AB_2209751 |
| Zfp795 | Novus Biologicals | Cat# NBP2-20947; RRID:AB_2848184 |
| Fra1 | ThermoFisher | Cat# PA5-40361; RRID:AB_2609389 |
| Onecut2 | Proteintech | Cat# 21916-1-AP; RRID:AB_2848180 |
| PDPN | Abcam | Cat# ab109059; RRID:AB_2848181 |
| RUNX2 | Abcam | Cat# ab23981; RRID:AB_777785 |
| CD45 | Abcam | Cat# ab10558; RRID:AB_442810 |
| CD11B-APC | eBioscience | Cat# 7-0112-82; RRID:AB_469344 |
| TER119-APC | BD Biosciences | Cat# 557909; RRID:AB_398635 |
| CD45-APC | BD Biosciences | Cat# 559864; RRID:AB_398672 |
| CD31-APC | Biolegend | Cat# 102510; RRID:AB_312917 |
| Bacterial and Virus Strains | ||
| Ad5-Sftpc-Cre | University of Iowa viral vector core facility | Cat# VVC-Berns-1168 |
| Biological Samples | ||
| Lung adenocarcinoma, 75 cases, tumor and matched NAT*, unstained slide | biomax | Cat# HLugA150CS02 |
| Lung cancer progression tissue array, including TNM, clinical stage and pathology grade, 100 cases/100 cores, replacing LC1005 | biomax | Cat # LC1005a |
| Lung disease spectrum (pulmonary cancer progression) tissue array, 193 cases/208 cores | biomax | Cat# LC2083 |
| Chemicals, Peptides, and Recombinant Proteins | ||
| NP-40 Surfact-Amps Detergent Solution | Thermo Scientific Nalgene | Cat# 28324 |
| Thermo Scientific Pierce Sequencing Grade Dimethylformamide | Thermo Fisher Scientific | Cat# 20673 |
| 0.5M EDTA pH 8.0 | Thermo Fisher Scientific | Cat# 15575-020 |
| Triton X-100 | Sigma Aldrich | Cat# T8787-50ML |
| HEPES (1M) | Life Technologies | Cat# 15630-080 |
| Tween(R)20, SigmaUltra | Sigma-Aldrich | Cat# P7949-100ML |
| NuPAGE MOPS SDS Running Buffer | Invitrogen | Cat# NP0001 |
| TBS Buffer 20X Liquid, 4L | Amresco | Cat# J640-4L |
| RIPA Buffer | Thermo Fisher Scientific | Cat# 89900 |
| Halt Phosphatase Inhibitor | Thermo Scientific | Cat# PI-78420 |
| Halt Protease Inhibitor Cocktail (100X) | Thermo Scientific | Cat# 78430 |
| NuPAGE LDS Sample Buffer (4X) | Life Technologies | Cat# NP0007 |
| NuPAGE Sample Reducing Agent (10X) | Invitrogen | Cat# NP0009 |
| NuPAGE Transfer Buffer (20X) | Life Technologies | Cat# NP0006-1 |
| Blotting-Grade Blocker | Bio-Rad | Cat# 170-6404 |
| Ponceau S | Sigma Aldrich | Cat# P7170-1L |
| NuPAGE Novex 4-12% Bis-Tris Protein Gels, 1.5mm, 10 well | Life Technologies | Cat# NP0335BOX |
| Amersham ECL Prime Western Blotting Detection Reagent | GE Healthcare | Cat# RPN2232 |
| Dual Endogenous Enzyme Blocking Kit | Agilent Technologies | Cat# S200389-2 |
| 2.5% Normal Horse Serum Blocking Solution | Vector Laboratories | Cat# S-2012 |
| ImmPRESS HRP Anti-Rabbit IgG (Peroxidase) Polymer | Vector Laboratories | Cat# mp-7401 |
| ACK lysing buffer | Thermo Fisher Scientific | Cat# a10492-01 |
| DMEM with L-Glutamine | VWR | Cat# 10-013-CV (45000-304) |
| 0.25% Trypsin-EDTA (1X) Phenol Red | Invitrogen | Cat# 25200-114 |
| RPMI 1640 | VWR | Cat# 15-040-CV |
| Tet System Approved FBS | Clontech | Cat# 631106 |
| Penicillin-Streptomycin | VWR | Cat# 45000-652 |
| S-MEM | Life Technologies | Cat# 11380-037 |
| RNase inhibitor | Thermo Fisher Scientific | Cat# N8080119 |
| DPBS, 1X without calcium and magnesium | VWR Scientific Inc | Cat# 21-031-CV |
| 10X PBS | VWR | Cat# AAJ67653-AP |
| Bovine Albumin Fraction V (7.5% solution) | Thermo Fisher Scientific | Cat# 15260037 |
| Glycine | VWR | Cat# 97061-128 |
| Collagenase from Clostridium histolyticum | Sigma-Aldrich | Cat# C9407-500MG |
| MgCl2 (1M) | Thermo Fisher Scientific | Cat# AM9530G |
| NaCl, 5M | ThermoFisher Scientific | Cat# AM9759 |
| Tris, Hydrochloride | Santa Cruz Biotechnology | Cat# sc-216106A |
| Sodium Dodecyl Sulfate | Bio-Rad | Cat# 161-0302 |
| Sybr Fast 2X MM LC480 | Kapa Biosystems | Cat# KK4611 |
| Thermo Scientific Pierce Methanol free Formaldehyde Ampules | Thermo Fisher Scientific | Cat# 28908 |
| Proteinase K, Recombinant, PCR grade solution | Sigma-Aldrich | Cat# 3115828001 |
| HBSS, no Calcium, no Magnesium, no Phenol Red | Thermo Fisher Scientific | Cat# 14175-079 |
| Invitrogen DNase I | Thermo Fisher Scientific | Cat# 18-047-019 |
| Collagenase, Type 4 | Worthington Biochemical | Cat# LS004189 |
| FastDigest Esp3I | Thermo Fisher Scientific | Cat# FD0454 |
| Puromycin | Invitrogen | Cat# a11138-02 |
| Zinc formalin fixative, pH 6.25 | Electron Microscopy Sciences | Cat# 21516.375 |
| Exonuclease I | New England Biolabs (NEB) | Cat# M0293S |
| Collagenase from Clostridium histolyticum | Sigma-Aldrich | Cat# C9407-500MG |
| ProLong Glass Antifade Mountant | Thermo Fisher Scientific | Cat# P36980 |
| Digitonin | Promega | Cat# G9441 |
| Critical Commercial Assays | ||
| Opal 4-Color Manual IHC Kit 50 slides | Akoya Biosciences | Cat# NEL810001KT |
| DAB Peroxidase Substrate Kit | Vector Labs | Cat# SK-4100 |
| NEBNext High-Fidelity 2X PCR Master Mix | New England Biolabs (NEB) | Cat# M0541L |
| Pierce BCA Protein Assay Kit | Thermo Fisher -- Pierce | Cat# 23227 |
| KAPA Library Quant for Illumina Sequencing Platforms | Kapa Biosystems | Cat# KK4824 |
| MinElute PCR Purification Kit | Qiagen | Cat# 28006 |
| Lung Dissociation Kit, mouse | Miltenyi Biotec | Cat# NC0315167 |
| RNeasy Plus Mini Kit | Qiagen | Cat# 74134 |
| High-Capacity cDNA reverse transcription kit | Thermo Fisher Scientific | Cat# 4368814 |
| Qubit dsDNA HS Assay Kit | Thermo Fisher Scientific | Cat# Q32854 |
| QIAGEN Plasmid Plus Midi Kit (25) | Qiagen | Cat# 12943 |
| QIAquick Gel Extraction Kit (250) | Qiagen | Cat# 28706 |
| SMARTer ThruPLEX DNA-Seq Kit - 24 Rxns | Takara Bio | Cat# R400674 |
| ECM Cell Adhesion Array Kit, colorimetric | Millipore Sigma | Cat# ECM540 |
| CD45 microbeads mouse | Miltenyi Biotec | Cat# 130-052-301 |
| Mouse L308 Array, Membrane | RayBiotech | Cat# AAM-BLM-1A-2 |
| Nextera DNA Library Preparation Kit | Illumina | Cat# FC-121-1030 |
| NextSeq 500/550 High Output Kit v2 | Illumina | Cat# FC-404-2002 |
| NextSeq | Illumina | Cat# FC-404-2005 |
| SureCell ATAC-Seq Library Preparation Kit | Bio-Rad | Cat# 17004620 |
| Agencourt AMPure XP | Beckman Coulter | Cat# A63880 |
| SureCell ddSEQ Index Kit | Bio-Rad | Cat# 12009360 |
| Agilent High Sensitivity DNA Kit | Agilent | Cat# 5067-4626 |
| TC20 Cell Counting Kit, with Trypan Blue | Bio-Rad | Cat# 1450003 |
| Deposited Data | ||
| ScATAC-seq data | This manuscript | GSE134812 |
| Early time point single cell data | This manuscript | GSE145192 |
| Bulk-ATACseq | This manuscript | GSE151403 |
| Visualization of UMAP scATAC-seq | This manuscript | https://buenrostrolab.shinyapps.io/lungATAC/ |
| UCSC genome browser tracks for normal cells | This manuscript | http://genome.ucsc.edu/s/lmlafave/normal_lung_scATAC |
| UCSC genome browser tracks for tumor modules | This manuscript | http://genome.ucsc.edu/s/lmlafave/KPT_modules |
| Experimental Models: Cell Lines | ||
| 860T3 KP cell line | This manuscript | N/A |
| 1183T3 KP cell line | This manuscript | N/A |
| 853T2 KP cell line | This manuscript | N/A |
| 860T1 KP cell line | This manuscript | N/A |
| 1183T4 KP cell line | This manuscript | N/A |
| 932T2 KP cell line | This manuscript | N/A |
| 932T3 KP cell line | This manuscript | N/A |
| 932LN KP cell line | This manuscript | N/A |
| 779T1 KP cell line | This manuscript | N/A |
| 779T2 KP cell line | This manuscript | N/A |
| 779LN KP cell line | This manuscript | N/A |
| Experimental Models: Organisms/Strains | ||
| KP mouse | Jackson et al., 2001, 2005 | stock 008179, stock 008462 |
| Tomato mouse (Ai9) | Jackson Labs | stock 007905 |
| B6129SF1/J | Jackson Labs | stock 101043 |
| Oligonucleotides | ||
| Genotyping primers | Table S7 | N/A |
| RUNX2 control g1f: CACCGGGCCACGAGTTCGAGATCGA | This manuscript | N/A |
| RUNX2 control g1r: AAACTCGATCTCGAACTCGTGGCCC | This manuscript | N/A |
| RUNX2 OE sg1a: CACCGGAGGAGGAAATCGA | This manuscript | N/A |
| RUNX2 OE sg1b: AAACTCGATTTCCTCCTCC | This manuscript | N/A |
| RUNX2 OE sg2a: CACCGGGCGGAGTCTGCTG | This manuscript | N/A |
| RUNX2 OE sg2b: AAACCAGCAGACTCCGCCC | This manuscript | N/A |
| RUNX1 KO sg1a: CACCGAGGAGTACCTTGAAAGCGAT | This manuscript | N/A |
| RUNX1 KO sg1b: AAACATCGCTTTCAAGGTACTCCTC | This manuscript | N/A |
| RUNX1 KO sg4a: CACCGTAGCGAGATTCAACGACCTC | This manuscript | N/A |
| RUNX1 KO sg4b: AAACGAGGTCGTTGAATCTCGCTAC | This manuscript | N/A |
| RUNX2 KO sg3a: CACCGTGCGGACCAGTTCGGCCGGG | This manuscript | N/A |
| RUNX2 KO sg3b: AAACCCCGGCCGAACTGGTCCGCAC | This manuscript | N/A |
| RUNX2 KO sg4a: CACCGGCCCTCGGAGAGGTACCAGA | This manuscript | N/A |
| RUNX2 KO sg4b: AAACTCTGGTACCTCTCCGAGGGCC | This manuscript | N/A |
| RUNX3 KO sg1a: CACCGGGACGTGCTGGCCGACCACG | This manuscript | N/A |
| RUNX3 KO sg1b:AAACCGTGGTCGGCCAGCACGTCCC | This manuscript | N/A |
| Recombinant DNA | ||
| lentiCRISPR-V2-puro | Joung et al., 2017 | Addgene #98290 |
| Lenti-Sam-puro | This manuscript | N/A |
| Lenti-Cas9-blast | Sanjana et al., 2014 | Addgene #52962 |
| Software and Algorithms | ||
| Aiforia (NSCLC_v25 algorithm) | This manuscript | https://www.aiforia.com/ |
| R (v3.5.3) | R Core Team, 2019 | https://www.R-project.org |
| chromVAR R package (v0.2.0) | Schep et al., 2017 | https://github.com/GreenleafLab/chromVAR |
| uwot R package (v0.1.4) | McInnes et al., 2018 | https://github.com/jlmelville/uwot |
| survival R package (2.41-3) | Therneau and Grambsch, 2000 | https://cran.r-project.org/web/packages/survival/index.html |
| GSEA (v3.0) | Subramanian et al., 2005 | https://www.gsea-msigdb.org/gsea/index.jsp |
| ImageJ (v1.52k) | Schneider, et al., 2012 | https://imagej.net/ |
| ImageJ Protein Array Analyzer (v1.1.c) | Carpentier, 2010 | https://imagej.net/macros/toolsets/Protein%20Array%20Analyzer.txt |
| FlowJo (v10.6.2) | N/A | www.flowjo.com |
| CaseViewer (v2.2.1) | N/A | https://www.3dhistech.com |
| MATLAB (v2019a) | Higham and Higham, 2016 | https://www.mathworks.com |
| Ilastik (v1.3.3) | Berg et al., 2019 | https://www.ilastik.org |
| MSigDB (v7.0) | Liberzon et al., 2015 | https://www.gsea-msigdb.org/gsea/msigdb/index.jsp |
| bowtie2 (v2.3.3.1) | Langmead et al., 2012 | http://bowtie-bio.sourceforge.net/bowtie2/index.shtml |
| MACS2 (v2.1.2) | Zhang et al., 2008 | https://github.com/taoliu/MACS/ |
| samtools (v1.9) | Li et al., 2009 | http://samtools.sourceforge.net |
| Picard toolkit (2.14.1-SNAPSHOT) | N/A | http://broadinstitute.github.io/picard |
| biomaRt (v2.34) | Durinck et al., 2005 | https://bioconductor.org/packages/release/bioc/html/biomaRt.html |
| ggfortify R package (v0.4.10) | Tang et al., 2016 | https://github.com/sinhrks/ggfortify |
| BAP (v0.5.9i) | Lareau et al., 2019 | https://github.com/caleblareau/bap |
| BWA (v0.7.15) | Li, 2013 | https://github.com/lh3/bwa |
| QuPath (0.1.2) | Bankhead et al., 2017 | https://qupath.github.io |
| Code generated for this manuscript | This study | https://github.com/buenrostrolab/lungATAC_analysis_code |