Table 2.

Mutations in LHCGR in the three families

Families	Genomic position (chr2)	cDNA change	Protein change	Mutation type	SIFT a	PPH2a	ExAC Eb	gnomADc
1	48982779	c.T32C	p.Leu11Pro	Missense	D	B	0	7.53 × 10−6
2	48915000	c.C1936T	p.Arg646Cys	Missense	T	D	0	4.6 × 10−5
	48936105	c.661dupG	p.Ala221Glyfs*63	Frameshift insertion	NA	NA	NA	NA
3	48950837	c.384-2A>T	–	Splicing	NA	NA	NA	NA
	48982753_48982779dup	c.32_58dupTGAAGCTGCTGCTGCTGCTGCAGCCGC	p.Leu11_Pro19dup	In-frame insertion	NA	NA	0	1.56 × 10−5

B, benign; T, tolerated; D, damaging; NA, not available

^aMutation assessment by SIFT and polyPhen-2 (PPH2)

^bFrequency of the corresponding mutations in the East Asian population of the ExAC Browser

^cFrequency of the corresponding mutations in gnomAD