Table 1.

Rigor Criteria with Applicable Guideline Source and Brief Description Listed

Entity Type	Source	What is This?
Rigor Criteria (5 Total Points)
Institutional Review Board Statementa	MDAR	A statement (usually a single sentence) addressing IRB approval for biomedical research involving human subjects (or why IRB approval was not required)
Example: All human work was conducted under human subjects protocols approved by the Stanford Institutional Review Board (IRB), the University of Michigan UM-IRBMED, and the ethical committee of d’Ile de France II. Example: The trial was approved by the NRES committee London—South East.
Consent Statementa	MDAR	A statement (usually a single sentence) addressing subject/patient consent in human research (or why consent was not required)
Example: Written informed consent was obtained from parents of all participating children and oral assent was obtained from 7-year-olds. Example: All infants were enrolled with informed parental permission under a protocol that was reviewed and approved by the Institutional Review Boards of the respective study sites.
Institutional animal care and use committee statement	MDAR, ARRIVE	A statement (usually a single sentence) addressing IACUC ethical approval for research involving vertebrate organisms
Example: All animal experiments were performed in accordance with relevant guidelines and regulations and were approved by the University of Pennsylvania Institutional Animal Care and Use Committee (IACUC). Example: All animals used in this study were treated in accordance with UK animal (scientific procedures) legislation and under the appropriate project licenses, national and local ethical approval.
Randomization of subjects into groups	MDAR, NIH, CONSORT, ARRIVE	Considered addressed when a statement describing whether randomization was used (e.g., assigning subjects to experimental groups, positions in a multiwell device, processing order, etc.)
Example: Animals were assigned to experimental groups using simple randomization. Example: Communication with schools, and elicitation of willingness to participate, was conducted before the village-level randomization took place.
Blinding of investigator or analysis	MDAR, NIH, CONSORT, ARRIVE	A statement discussing the degree to which experimenters were unaware (or blinded) of group assignment and/or outcome assessment
Example: Responses were then scored by an experimenter blinded to injection condition and experimental cohort. Example: All the analysis was performed by a person unaware of the experimental question.
Power analysis for group size	MDAR, NIH, CONSORT, ARRIVE	A statement addressing how (and if) an appropriate sample size was computed
Example: Sample size was based on estimations by power analysis with a level of significance of 0.05 and a power of 0.9. Example:Sample size calculation was done for the primary aim of this study, i.e., FMD, as reported previously.
Sex as a biological variable	MDAR, NIH, CONSORT, ARRIVE	Reporting the sex of any and all organisms, cell lines, and human subjects
Example: Six healthy adult rhesus macaques (Macaca mulatta) of Chinese origin (4–8 kg, three males and three females, 4–8 years old) were inoculated intramuscularly (i.m.) with 1,000 pfu of EBOV Makona strain. Example: In each session, the behavior of each mother was recorded every 2 min.
Cell Line Authenticationb	MDAR, NIH	A statement detailing how the cell lines used were authenticated (e.g., short tandem repeat analysis). This is only required when cell lines are detected
Example: MOLM-14 cells were authenticated by STR profiling and flow cytometry. Example: All cell lines were obtained from ATCC, tested negative for mycoplasma, and their identity was verified by short tandem repeat analysis (Promega GenePrint 10 system).
Cell Line Contamination Checkb	MDAR, NIH	A statement addressing the mycoplasma contamination status of the cell lines used. This is only required when cell lines are detected
Example: All cell lines were obtained from ATCC and tested negative for mycoplasma contamination. Example: All cell lines were confirmed to be mycoplasma free using a PCR-based detection strategy with positive and negative controls.
Key Biological Resources (5 Total Points)
Antibody	MDAR, NIH, STAR, RRID	SciScore attempts to find all antibody entities within the methods section. “Identifiable” antibodies are reported with any metadata required to uniquely identify the antibody used such as vendor, catalog number, clone ID, batch number, or RRID
Example: ATF3 antibody (Santa Cruz Biotechnology) was used at 1:2000. Example: Slices were then washed (3x) and placed in PBS containing the following: 1% (vol/vol) normal goat serum, 1% (vol/vol) BSA, 0.25% (vol/vol) Triton X-100, and mouse monoclonal anti-5.8S rRNA, clone Y10b at 1:500 (Abcam, ab37144, RRID: AB_777714) overnight at 4°C.
Organism	MDAR, NIH, RRID, STAR, ARRIVE	SciScore attempts to find all organism entities within the methods section. “Identifiable” organisms are reported with any metadata required to uniquely identify the organism used such as vendor, catalog number, or RRID
Example (mouse): Adult (10–12 weeks; 25–30g) male C57BL/6 and TH-Cre mice were group-housed until surgery. Example (fly): To generate PIP821bpΔ the following sgRNA was generated 5′-GCAGGAGGAGGTACAGCGGG-3′ and cloned into pU6-2-BbsI-gRNA (DGRC #1363) and then subsequently injected into w1118; vas-Cas9 (RRID:BDSC_51324, rainbow transgenics). Example (fish): The transgenic lines used in this study were Tg(kdrl:EGFP)s843 (Jin et al., 2005), Tg(lyve1b:dsRed2)nz101, Tg(lyve1b:EGFP)nz150 (Okuda et al., 2012), Tg(mpeg1:EGFP)gl22, Tg(mpeg1:Gal4FF) gl25 (Ellett et al., 2011), Tg(lyz:EGFP)nz117 (Hall et al., 2007), Tg(i-fabp:RFP)as200 (Her et al., 2004), Tg(UAS-E1b:nfsB-mCherry)c264 (Davison et al., 2007) and Tg(-8.mpx:KalTA4)gl28.
Cell line	MDAR, NIH, STAR, RRID	SciScore attempts to find all cell line entities within the methods section. “Identifiable” cell lines are reported with any metadata required to uniquely identify the cell line used such as vendor, catalog number, or RRID
Example: The lung cancer cell line, H1299, was obtained from the American Tissue Culture Collection (Manassas, VA). Example:J774A.1 murine monocytes and macrophages (ATCC, number TIB-67) were cultured at 37°C in a humidified air/carbon dioxide (CO2) (19:1) atmosphere in RPMI medium supplemented with 10% (v/v) heat-inactivated fetal bovine serum, penicillin (100 IU/mL), streptomycin (100 μg/mL), and amphotericin B (250 ng/mL).
Plasmidc	STAR, RRID	SciScore attempts to find all plasmid entities within the methods section. Plasmids were not used in this analysis
Example: The constructions were prepared using the vector pSpCas9(BB)-2A-Puro (PX459) V2.0, which was a gift from Feng Zhang (Addgene plasmid #62988; RRID: Addgene_62988). Example: For expression in HEK293 cells, INF2 was first subcloned into pGADT7.3 (BspEI/XmaI-XhoI) and then into pEGFP-C3 (EcoRI-SalI).
Oligonucleotidec	STAR	SciScore attempts to find all oligonucleotide entities within the methods section. Oligonucleotides do not impact score and were not used in this analysis
Example: Activating Notch1 mutations in mouse models of T-ALL (Blood 2006,107:781–785), including one new oligonucleotide primer pair: Ex34B-f: 5′-GCCAGTACAACCCACTACGG-3′; Ex34B-r: 5′-CCTGAAGCACTGGAA-AGGAC-3′. Example: Primers used were GRHL2-1-424-F (TATATAGGATCCATGTCACAAGAGTCGGACAA), GRHL2-1-424-R (ATATAAAGATCTT-TTTCTTTCTGCTCCTTTGT), GRHL2-438-625-F (TAAATTAGATCTAAAGGCCAGGCCTCCCAA-AC), and GRHL2-438-625-R (TTATATGTCGACCTAGATTTCCATGAGCGTGA).
Software Project/Tool	STAR, RRID	SciScore attempts to find all software tools within the methods section. “Identifiable” tools are reported with an RRID or are able to be uniquely identified through a distinct name/URL
Example: ImageJ was used to process and analyze raw images. Example: All simulations were performed using the NEURON simulation environment (Carnevale and Hines, 2006).

SciScore was trained to recognize each of these criteria, with the training dataset size and classifier performance listed in Table S1. Example sentences recognized by SciScore are listed for each criterion, and we have underlined the entity that was likely to be recognized by the tool. These types of entities were annotated by curators to train individual classifiers.

^aInstitutional Review Board and consent statements are scored together as a block where detection of one or more of these entities will give the full point value for this section.

^bCell line authentication and contamination statements are only scored when a cell line is detected in the key resources table and they are scored together, either of these will provide the full points for this section.

^cEntity type not used for analysis in the current paper.