Antibodies |
|
Anti CD4 AF700 Rat monoclonal RM4-4 |
BioLegend |
Cat# 116022; RRID: AB_2715957
|
Anti CD4 BUV737 Rat monoclonal GK1.5 |
BDBiosciences |
Cat# 564298; RRID: AB_2738734
|
Anti TCRVβ 8.1/8.2 PerCP-eFluor710 Rat monoclonal KJ16-133 |
ThermoFisher |
Cat# 46-5813-82; RRID: AB_10549113
|
Anti TCRVβ 8.1/8.2 BUV395 Rat monoclonal MR5-2 |
BDBiosciences |
Cat# 744335; RRID: AB_2742163
|
Anti TCRβ AF700 Armenian Hamster monoclonal H57-597 |
BioLegend |
Cat# 109223; RRID: AB_109223
|
Anti CD69 APC Armenian Hamster monoclonal H1.2F3 |
BioLegend |
Cat# 104513; RRID: AB_492844
|
Anti CD8 AF700 Rat monoclonal 53-6.7 |
BioLegend |
Cat# 100729; RRID: AB_493702
|
Anti CD8 BUV395 Rat monoclonal 53-6.7 |
BDBiosciences |
Cat# 563786; RRID: AB_2732919
|
Anti TCR Vα2 PerCP/Cyanine5.5 Rat monoclonal B20.1 |
BioLegend |
Cat# 127813; RRID: AB_1186118
|
Anti TCR Vβ5.1/5.2 APC Mouse monoclonal MR9-4 |
BioLegend |
Cat# 139505; RRID: AB_10897800
|
Anti B220 PerCP-Cy5.5 Rat monoclonal RA3-6B2 |
BDBiosciences |
Cat# 561101; RRID: AB_10565970
|
Anti CD43 Biotin Rat monoclonal S7 |
BDBiosciences |
Cat# 553269; RRID: AB_2255226
|
Anti IgM PE-Cy7 Rat monoclonal RMM-1 |
BioLegend |
Cat# 406513; RRID AB_10640069
|
Anti IgD APC Rat monoclonal 11-26C |
Invitrogen |
Cat# 17-5993-82; RRID: AB_10598660
|
Anti CD21 APC Rat monoclonal 7G6 |
BDBiosciences |
Cat# 561770; RRID: AB_10892818
|
Anti CD23 PE-Cy7 Rat monoclonal B3B4 |
ThermoFisher |
Cat# 25-0232-82; RRID: AB_469604
|
Anti CD25 PerCP/Cy5.5 Rat monoclonal PC61 |
BioLegend |
Cat# 102029; RRID: AB_893291
|
Anti CD19 BUV737 Rat monoclonal 1D3 |
BDBiosciences |
Cat# 564296; RRID: AB_2716855
|
Anti CD3ε Armenian Hamster monoclonal 145-2C11 |
BioLegend |
Cat# 100301; RRID: AB_312666
|
|
Chemicals, Peptides, and Recombinant Proteins |
|
Streptavidin BV711 |
BioLegend |
Cat# 405241 |
MBP Ac1-9[4Y] peptide AcASQYRPSQR |
GL Biochem Shanghai |
Custom product |
N4 OVA 257-264 SIINFEKL peptide |
GL Biochem Shanghai |
Cat# 181660 |
Q4 OVA 257-264 SIIQFEKL peptide |
GL Biochem Shanghai |
Cat# 151560 |
V4 OVA 257-264 SIIVFEKL peptide |
GL Biochem Shanghai |
Cat# 151561 |
Cyclosporin A |
Cell Guidance Systems |
Cat# SM43; CAS: 59865-13-3 |
FK506 (Tacrolimus) |
Cayman Chemical |
Cat# 10007965; CAS: 59865-13-3 |
PD 0325901 |
Cayman Chemical |
Cat# 13034; CAS: 391210-10-9 |
DMSO |
Sigma Aldrich |
Cat# D2650; CAS: 67-68-5 |
PP2 |
Sigma Aldrich |
Cat# P0042; CAS: 172889-27-9 |
|
Critical Commercial Assays |
|
RNeasy mini kit |
QIAGEN |
Cat# 74104 |
Invitrogen Superscript IV Reverse Transcriptase |
ThermoFisher |
Cat# 18090050 |
Invitrogen Random hexamers |
ThermoFisher |
Cat# N8080127 |
Applied Biosystems SYBR green power up master mix |
ThermoFisher |
Cat# A25752 |
eFluor-780 fixable viability dye |
eBioscience |
Cat# 65-0865-14 |
MoJo Sort nanobeads: CD8 T Cell Isolation Kit |
BioLegend |
Cat# 480035 |
MoJo Sort nanobeads: naive CD4 T Cell Isolation Kit |
BioLegend |
Cat# 480039 |
|
Deposited Data |
|
RNA-seq of CA-RIT-NFAT1 CD8 T cells, NFAT1 ChIP-seq of WT and NFAT−/− CD8 T cells |
Martinez et al., 2015 |
GEO: GSE64409
|
|
Experimental Models: Organisms/Strains |
|
Mouse: Nr4a3-Tocky founder line 323 |
Bending et al., 2018b; Obtained from Dr. Masahiro Ono from Imperial College London under MTA |
PMID: 29941474
|
Mouse:Tg4-H2U
|
Liu et al., 1995; Provided by Prof. David Wraith University of Birmingham |
PMID: 7584132 |
Mouse: IL-10-GFP Tiger |
Kamanaka et al., 2006; Provided by Prof. David Wraith University of Birmingham |
PMID: 17137799
|
Mouse: Great-Smart17A |
Price et al., 2012; Obtained from Prof. Richard Locksley from University of California, San Francisco under MTA |
PMID: 22768117
|
Mouse: Nr4a1/Nur77-GFP |
Moran et al., 2011; Provided by Prof. Graham Anderson University of Birmingham |
PMID: 21606508
|
Mouse: OTI |
Charles River Laboratories |
Strain Code: 642 |
|
Oligonucleotides |
|
Hprt for: AGCCTAAGATGAGCGCAAGT rev: TTACTAGGCAGATGGCCACA |
Bending et al., 2018a |
PMID: 29991564
|
Nr4a1 for: TGTGAGGGCTGCAAGGGCTTC rev: AAGCGGCAGAACTGGCAGCGG |
Sekiya et al., 2013 |
PMID: 23334790
|
Nr4a2 for: CTGTGCGCTGTTTGCGGTGAC rev: CGGCGCTTGTCCACTGGGCAG |
Sekiya et al., 2013 |
PMID: 23334790
|
Nr4a3 for: AGGGCTTCTTCAAGAGAACGG rev: CCATCCCGACACTGAGACAC |
This paper, Designed using NCBI Primer Blast |
N/A |
|
Software and Algorithms |
|
GraphPad Prism 7 and 8 |
|
https://www.graphpad.com/scientific-software/prism/ |
FlowJo v10.5.3 |
|
https://www.flowjo.com/solutions/flowjo |
CyVerse Discovery Environment |
|
https://cyverse.org/discovery-environment |
UCSC genome browser |
|
https://genome.ucsc.edu |