Key resources table.
Reagent type (species) or resource |
Designation | Source or reference |
Identifiers | Additional information |
---|---|---|---|---|
Gene Mus musculus |
Mfn-2 | NCBI Gene | Gene ID: 170731 |
MFN2
ENSMUSG00000029020 |
Gene (Human) | MFN-2 | NCBI Gene | Gene ID: 9927 | MFN2 ENSG00000116688 |
Genetic reagent (M. musculus) | Rosa-STOP-mMFN Thr105Met (T105M) mice | (C57BL/6 Gt(ROSA) 26 Sortm1 (CAG MFN2*T105M)Dple/) | The Jackson Laboratory: 025322 | C57Bl/6 |
Genetic reagent M. musculus | HB9-Cre mice | (B6.129S1-Mnx1tm4(cre)Tmj/J) | The Jackson Laboratory : 006600 |
C57Bl/6 |
Genetic reagent M. musculus | C57BL/6J mice | C57Bl/6 | The Jackson Laboratory : 000664 |
C57Bl/6 |
Mfn2 null M. musculus |
Mfn2 null MEFs | ATCC | CRL-2994 | Murine embryonic fibroblasts |
Mfn1/Mfn2 null
M. musculus |
Mfn1 and Mfn2 double knock out MEFs | ATCC | CRL-2993 | Murine embryonic fibroblasts |
Mfn1 null M. musculus |
Mfn1 null MEFs | ATCC | CRL-2992 | Murine embryonic fibroblasts |
Cell line (H. sapiens) |
Dermal fibroblast (MFN2 T105M) | Dr. Robert H. Baloh (Cedars Sinai) | Female | |
Cell line (H. sapiens) |
Dermal fibroblast (MFN2 H361Y) | Dr. Robert H. Baloh (Cedars Sinai) | Male | |
Cell line (H. sapiens) |
Dermal fibroblast (MFN2 R274W) | Dr. Barbara Zablocka (Mossakowski Med Res Ctr) | PMID:28076385 | Male |
Cell line (H. sapiens) |
Dermal fibroblast (MFN2 R364W) | Dr. Michael E. Shy (University of Iowa) | Female | |
Cell line (H. sapiens) |
Dermal fibroblast (Normal) | NINDS | ND34769 | Female |
Cell line (H. sapiens) | Dermal fibroblast (Normal) | NINDS | ND36320 | Female |
Cell line (H. sapiens) |
Dermal fibroblast (Normal) | NINDS | ND29510 | Female |
Transfected construct (Human Adenovirus Type5 (dE1/E3)) | Adenovirus β-galactosidase |
Vector Biolabs | Cat#: 1080 | |
Transfected construct (Human Adenovirus Type5 (dE1/E3)) | Adenovirus Mito-Ds-Red2 |
Signagen | Cat#: 12259 | |
Transfected construct (Human Adenovirus Type5 (dE1/E3)) | Adenovirus Cre-recombinase |
Vector Biolabs | Cat#: 1794 | |
Recombinant DNA reagent | rtTA-N144 (plasmid) | Addgene | Cat#: 66810 | Lentiviral construct to transfect and express the plasmid |
Recombinant DNA reagent | pTight-9-124-BclxL (plasmid) |
Addgene | Cat#: 60857 | Lentiviral construct to transfect and express the plasmid |
Recombinant DNA reagent | LHX3-N174 and ISL1-N174 (plasmid) | PMID:28886366 | Lentiviral construct to transfect and express the plasmid | |
Antibody | Anti-Mfn-2 (Mouse monoclonal) |
AbCAM | Cat#: ab56889 | (1:1000) |
Antibody | Anti-COX-IV (Rabbit polyclonal) |
AbCAM | Cat#: ab16056 | (1:1000) |
Antibody | Anti-Stathmin-2 (Rabbit polyclonal) |
Novus Biologicals | Cat#: NBP1-49461 | (1:1000) |
Antibody | Anti-GAPDH (Mouse monoclonal) |
AbCAM | Cat#: ab8245 | (1:3000) |
Antibody | Anti-FSP-1 (Rabbit polyclonal) |
Novus Biologicals | Cat#: NBP1-49461 | (1:400) |
Antibody | Anti-MNX1 (Mouse monoclonal) |
DSHB | Cat#: 81.5C10 | (2 µg/ml) |
Antibody | Anti-β-tubulin III (Mouse monoclonal) |
Biolegend | Cat#: 801201 | (1:200) |
Antibody | Alexa-Fluor 488 (Goat anti-mouse) |
ThermoFisher | Cat#: A11029 | (1:400) |
Antibody | Alexa- Fluor 488 (Goat anti-rabbit) |
ThermoFishe | Cat#: A11008 | (1:400) |
Antibody | (Goat anti-rabbit IgG) | ThermoFisher | Cat#: 31460 | (1:3000) |
Antibody | Alexa- Fluor 594 (Goat anti rabbit) |
ThermoFisher | Cat#: A32740 | (1:400) |
Antibody | (Peroxidase-conjugated anti-mouse IgG) | Cell Signaling | Cat#: 7076S | (1:3000) |
Antibody | (α-Bungarotoxin Alexa flour 594) |
ThermoFisher | Cat#: B12423 | (0.5 μg/ml) |
Sequence-based reagent | HB9CRE Fw | The Jackson Laboratory | 006600 | CTAGGCCACAGAATTGAAAGATCT |
Sequence-based reagent | HB9CRE Rv | The Jackson Laboratory | 006600 | GTAGGTGGAAATTCTAGCATCATCC |
Sequence-based reagent | HB9CRE TG Fw | The Jackson Laboratory | 006600 | GCGGTCTGGCAGTAAAAACTATC |
Sequence-based reagent | HB9CRE TG Rv | The Jackson Laboratory | 006600 | GTGAAACAGCATTGCTGTCACTT |
Sequence-based reagent | Mfn2 T105M M Fw | The Jackson Laboratory | 025322 | GACCCCGTTACCACAGAAGA |
Sequence-based reagent | Mfn2 T105M M Rv | The Jackson Laboratory | 025322 | AACTTTGTCCCAGAGCATGG |
Sequence-based reagent | Mfn2 T105M Wt Fw | The Jackson Laboratory | 025322 | AAGGGAGCTGCAGTGGAGTA |
Sequence-based reagent | Mfn2 T105M Wt Rv | The Jackson Laboratory | 025322 | CCGAAAATCTGTGGGAAGTC |
Sequence-based reagent | MFN2 T105M Fw | This paper | PCR primers for cell line mutation validation | TTGCACTGAATAGGGCTTTG |
Sequence-based reagent | MFN2 T105M Rv | This paper | PCR primers for cell line mutation validation | CATTCACCTCCACAGGGTG |
Sequence-based reagent | MFN2 R274W Fw | This paper | PCR primers for cell line mutation validation | CGTGGTAGGTGTCTACAAGAAGC |
Sequence-based reagent | MFN2 R274W Rv | This paper | PCR primers for cell line mutation validation | CTGGTGAGGGCTGATGAAAT |
Sequence-based reagent | MFN2 H361Y and R364W Fw | This paper | PCR primers for cell line mutation validation | CCTGGCAGTGAAAACCAGAG |
Sequence-based reagent | MFN2 H361Y and R364W Rv | This paper | PCR primers for cell line mutation validation | AAGGCGTGTCCTAACTGCC |
Chemical compound, drug | Trans-MiM111 | Mitochondria in Motion, Inc | Cpd 13b in PMID:32506913 | |
Chemical compound, drug | Chimera C | Paraza Pharma | Cpd 2 in PMID:32506913 | |
Chemical compound, drug | Papain | Sigma | Cat#: P4762 | |
Chemical compound, drug | Laminin | Sigma | Cat#: L2020 | |
Chemical compound, drug | Poly-d-Lysine | Sigma | Cat#: P7886 | |
Chemical compound, drug | Poly-ornithine | Sigma-Aldrich | Cat#: P4957 | |
Chemical compound, drug | Fibronectin | Sigma-Aldrich | Cat#: F4759 | |
Chemical compound, drug | Polybrene | Sigma-Aldrich | Cat#: H9268 | |
Chemical compound, drug | Doxycycline | Sigma-Aldrich | Cat#: D9891 | |
Chemical compound, drug | G418/Geneticin | Invitrogen | Cat#: 10131-035 | |
Chemical compound, drug | Retinoic Acid | Sigma | Cat#: R2625 | |
Chemical compound, drug | BDNF, NT-3, CNTF, GDNF | Peprotech | Cat#: 450-02, Cat#: 450-03, Cat#: 450-13, Cat#: 450-10 | |
Chemical compound, drug | Dibutyryl cAMP | Sigma | Cat#: D0627 | |
Chemical compound, drug | Valproic acid | Sigma | Cat#: 676380 | |
Chemical compound, drug | Puromycin | Invitrogen | Cat#: A11138-03 | |
Chemical compound, drug | Collagenase | Worthington Biochemical | Cat#: 41J12861 | |
Chemical compound, drug | (2-Hydroxypropyl)-β-cyclodextrin | Sigma | Cat#: 332607 | |
Chemical compound, drug |
Carbonyl cyanide-p-trifluoromethoxyphenyl hydrazone | Sigma | Cat#: C2759 | |
Chemical compound, drug | B27 supplement | Gibco | Cat#: 17504-044 | |
Chemical compound, drug | Insulin-transferrin-sodium selenite | Sigma | Cat#: 1884 | |
Chemical compound, drug | Glucose | Sigma | Cat#: G5767 | |
Chemical compound, drug | L-glutamine | Gibco | Cat#: 25030-149 | |
Chemical compound, drug | Goat serum | Jackson Immunoresearch | Cat#: 005-000121 | |
Chemical compound, drug | Glutaraldehyde | Electron Microscopy Science | Cat#: 16216 | |
Chemical compound, drug | MitoTracker Green | Thermo Fisher | Cat#: M7514 | |
Chemical compound, drug | Calcein AM | Thermo Fisher | Cat#: C3100MP | |
Chemical compound, drug | Hoechst | Thermo Fisher | Cat#: H3570 | |
Chemical compound, drug | MitoTracker Orange | Thermo Fisher | Cat#: M7510 | |
Chemical compound, drug | Tetramethylrhodamine ethyl ester | Thermo Fisher | Cat#: T-669 | |
Software, algorithm | ImageJ | C. A. Schneider | https://imagej.net/Sholl_Analysis | |
Software, algorithm | Viasys Healthcare Nicolet Biomedical instrument with Viking Quest version 11.2 software | Middleton | Cat#: OL060954 | |
Software, algorithm | Gallios instrument with FlowJo 10 software | Beckman Coulter | N/A | |
Other | RotaRod | Ugo Basile | Cat#: 47650 | |
Other | XonaChips | Xona Microfluidics | Cat#: XC450 |