Skip to main content
. 2020 Oct 19;9:e61119. doi: 10.7554/eLife.61119

Key resources table.

Reagent type
(species) or
resource
Designation Source or
reference
Identifiers Additional
information
Gene
Mus musculus
Mfn-2 NCBI Gene Gene ID: 170731 MFN2
ENSMUSG00000029020
Gene (Human) MFN-2 NCBI Gene Gene ID: 9927 MFN2
ENSG00000116688
Genetic reagent (M. musculus) Rosa-STOP-mMFN Thr105Met (T105M) mice (C57BL/6 Gt(ROSA) 26 Sortm1 (CAG MFN2*T105M)Dple/) The Jackson Laboratory: 025322 C57Bl/6
Genetic reagent M. musculus HB9-Cre mice (B6.129S1-Mnx1tm4(cre)Tmj/J) The Jackson Laboratory :
006600
C57Bl/6
Genetic reagent M. musculus C57BL/6J mice C57Bl/6 The Jackson Laboratory :
000664
C57Bl/6
Mfn2 null
M. musculus
Mfn2 null MEFs ATCC CRL-2994 Murine embryonic fibroblasts
Mfn1/Mfn2 null
M. musculus
Mfn1 and Mfn2 double knock out MEFs ATCC CRL-2993 Murine embryonic fibroblasts
Mfn1 null
M. musculus
Mfn1 null MEFs ATCC CRL-2992 Murine embryonic fibroblasts
Cell line
(H. sapiens)
Dermal fibroblast (MFN2 T105M) Dr. Robert H. Baloh (Cedars Sinai) Female
Cell line
(H. sapiens)
Dermal fibroblast (MFN2 H361Y) Dr. Robert H. Baloh (Cedars Sinai) Male
Cell line
(H. sapiens)
Dermal fibroblast (MFN2 R274W) Dr. Barbara Zablocka (Mossakowski Med Res Ctr) PMID:28076385 Male
Cell line
(H. sapiens)
Dermal fibroblast (MFN2 R364W) Dr. Michael E. Shy (University of Iowa) Female
Cell line
(H. sapiens)
Dermal fibroblast (Normal) NINDS ND34769 Female
Cell line (H. sapiens) Dermal fibroblast (Normal) NINDS ND36320 Female
Cell line
(H. sapiens)
Dermal fibroblast (Normal) NINDS ND29510 Female
Transfected construct (Human Adenovirus Type5 (dE1/E3)) Adenovirus
β-galactosidase
Vector Biolabs Cat#: 1080
Transfected construct (Human Adenovirus Type5 (dE1/E3)) Adenovirus
Mito-Ds-Red2
Signagen Cat#: 12259
Transfected construct (Human Adenovirus Type5 (dE1/E3)) Adenovirus
Cre-recombinase
Vector Biolabs Cat#: 1794
Recombinant DNA reagent rtTA-N144 (plasmid) Addgene Cat#: 66810 Lentiviral construct to transfect and express the plasmid
Recombinant DNA reagent pTight-9-124-BclxL
(plasmid)
Addgene Cat#: 60857 Lentiviral construct to transfect and express the plasmid
Recombinant DNA reagent LHX3-N174 and ISL1-N174 (plasmid) PMID:28886366 Lentiviral construct to transfect and express the plasmid
Antibody Anti-Mfn-2
(Mouse monoclonal)
AbCAM Cat#: ab56889 (1:1000)
Antibody Anti-COX-IV
(Rabbit polyclonal)
AbCAM Cat#: ab16056 (1:1000)
Antibody Anti-Stathmin-2
(Rabbit polyclonal)
Novus Biologicals Cat#: NBP1-49461 (1:1000)
Antibody Anti-GAPDH
(Mouse monoclonal)
AbCAM Cat#: ab8245 (1:3000)
Antibody Anti-FSP-1
(Rabbit polyclonal)
Novus Biologicals Cat#: NBP1-49461 (1:400)
Antibody Anti-MNX1
(Mouse monoclonal)
DSHB Cat#: 81.5C10 (2 µg/ml)
Antibody Anti-β-tubulin III
(Mouse monoclonal)
Biolegend Cat#: 801201 (1:200)
Antibody Alexa-Fluor 488
(Goat anti-mouse)
ThermoFisher Cat#: A11029 (1:400)
Antibody Alexa- Fluor 488
(Goat anti-rabbit)
ThermoFishe Cat#: A11008 (1:400)
Antibody (Goat anti-rabbit IgG) ThermoFisher Cat#: 31460 (1:3000)
Antibody Alexa- Fluor 594
(Goat anti rabbit)
ThermoFisher Cat#: A32740 (1:400)
Antibody (Peroxidase-conjugated anti-mouse IgG) Cell Signaling Cat#: 7076S (1:3000)
Antibody (α-Bungarotoxin
Alexa flour 594)
ThermoFisher Cat#: B12423 (0.5 μg/ml)
Sequence-based reagent HB9CRE Fw The Jackson Laboratory 006600 CTAGGCCACAGAATTGAAAGATCT
Sequence-based reagent HB9CRE Rv The Jackson Laboratory 006600 GTAGGTGGAAATTCTAGCATCATCC
Sequence-based reagent HB9CRE TG Fw The Jackson Laboratory 006600 GCGGTCTGGCAGTAAAAACTATC
Sequence-based reagent HB9CRE TG Rv The Jackson Laboratory 006600 GTGAAACAGCATTGCTGTCACTT
Sequence-based reagent Mfn2 T105M M Fw The Jackson Laboratory 025322 GACCCCGTTACCACAGAAGA
Sequence-based reagent Mfn2 T105M M Rv The Jackson Laboratory 025322 AACTTTGTCCCAGAGCATGG
Sequence-based reagent Mfn2 T105M Wt Fw The Jackson Laboratory 025322 AAGGGAGCTGCAGTGGAGTA
Sequence-based reagent Mfn2 T105M Wt Rv The Jackson Laboratory 025322 CCGAAAATCTGTGGGAAGTC
Sequence-based reagent MFN2 T105M Fw This paper PCR primers for cell line mutation validation TTGCACTGAATAGGGCTTTG
Sequence-based reagent MFN2 T105M Rv This paper PCR primers for cell line mutation validation CATTCACCTCCACAGGGTG
Sequence-based reagent MFN2 R274W Fw This paper PCR primers for cell line mutation validation CGTGGTAGGTGTCTACAAGAAGC
Sequence-based reagent MFN2 R274W Rv This paper PCR primers for cell line mutation validation CTGGTGAGGGCTGATGAAAT
Sequence-based reagent MFN2 H361Y and R364W Fw This paper PCR primers for cell line mutation validation CCTGGCAGTGAAAACCAGAG
Sequence-based reagent MFN2 H361Y and R364W Rv This paper PCR primers for cell line mutation validation AAGGCGTGTCCTAACTGCC
Chemical compound, drug Trans-MiM111 Mitochondria in Motion, Inc Cpd 13b in PMID:32506913
Chemical compound, drug Chimera C Paraza Pharma Cpd 2 in PMID:32506913
Chemical compound, drug Papain Sigma Cat#: P4762
Chemical compound, drug Laminin Sigma Cat#: L2020
Chemical compound, drug Poly-d-Lysine Sigma Cat#: P7886
Chemical compound, drug Poly-ornithine Sigma-Aldrich Cat#: P4957
Chemical compound, drug Fibronectin Sigma-Aldrich Cat#: F4759
Chemical compound, drug Polybrene Sigma-Aldrich Cat#: H9268
Chemical compound, drug Doxycycline Sigma-Aldrich Cat#: D9891
Chemical compound, drug G418/Geneticin Invitrogen Cat#: 10131-035
Chemical compound, drug Retinoic Acid Sigma Cat#: R2625
Chemical compound, drug BDNF, NT-3, CNTF, GDNF Peprotech Cat#: 450-02, Cat#: 450-03, Cat#: 450-13, Cat#: 450-10
Chemical compound, drug Dibutyryl cAMP Sigma Cat#: D0627
Chemical compound, drug Valproic acid Sigma Cat#: 676380
Chemical compound, drug Puromycin Invitrogen Cat#: A11138-03
Chemical compound, drug Collagenase Worthington Biochemical Cat#: 41J12861
Chemical compound, drug (2-Hydroxypropyl)-β-cyclodextrin Sigma Cat#: 332607
Chemical
compound, drug
Carbonyl cyanide-p-trifluoromethoxyphenyl hydrazone Sigma Cat#: C2759
Chemical compound, drug B27 supplement Gibco Cat#: 17504-044
Chemical compound, drug Insulin-transferrin-sodium selenite Sigma Cat#: 1884
Chemical compound, drug Glucose Sigma Cat#: G5767
Chemical compound, drug L-glutamine Gibco Cat#: 25030-149
Chemical compound, drug Goat serum Jackson Immunoresearch Cat#: 005-000121
Chemical compound, drug Glutaraldehyde Electron Microscopy Science Cat#: 16216
Chemical compound, drug MitoTracker Green Thermo Fisher Cat#: M7514
Chemical compound, drug Calcein AM Thermo Fisher Cat#: C3100MP
Chemical compound, drug Hoechst Thermo Fisher Cat#: H3570
Chemical compound, drug MitoTracker Orange Thermo Fisher Cat#: M7510
Chemical compound, drug Tetramethylrhodamine ethyl ester Thermo Fisher Cat#: T-669
Software, algorithm ImageJ C. A. Schneider https://imagej.net/Sholl_Analysis
Software, algorithm Viasys Healthcare Nicolet Biomedical instrument with Viking Quest version 11.2 software Middleton Cat#: OL060954
Software, algorithm Gallios instrument with FlowJo 10 software Beckman Coulter N/A
Other RotaRod Ugo Basile Cat#: 47650
Other XonaChips Xona Microfluidics Cat#: XC450