Key resources table.
| Reagent type (species) or resource |
Designation | Source or reference |
Identifiers | Additional information |
|---|---|---|---|---|
| Genetic reagent (Mus musculus) | FVB/NJ | Jackson Laboratory | stock no. 001800 RRID:IMSR_JAX:001800 |
|
| Genetic reagent (Mus musculus) | Iftt122TR2 | This study | FVB/N background | |
| Genetic reagent (Mus musculus) | Ttc21bTF2 | This study | FVB/N background | |
| Genetic reagent (Mus musculus) | SmoM2 | Jackson Laboratory (Jeong et al., 2004) |
Gt(ROSA)26Sortm1(Smo/EYFP)Amc/Jstock no. 005130 MGI:3576373 RRID:IMSR_JAX:005130 |
C57BL/6J background |
| Genetic reagent (Mus musculus) | Wnt1-Cre2 | Jackson Laboratory (Lewis et al., 2013) |
E2f1Tg(Wnt1-cre)2Sor/Jstock no. 022137 MGI:5485027 RRID:IMSR_JAX:022137 |
FVB/N background |
| Genetic reagent (Mus musculus) | EIIA-Cre | Jackson Laboratory (Lakso et al., 1996) | Tg(EIIa-cre)C5379Lmgd/Jstock no. 003314 MGI:2137691 RRID:IMSR_JAX:003314 |
FVB/N background |
| Genetic reagent (Mus musculus) | mT/mG | Jackson Laboratory (Muzumdar et al., 2007) |
Gt(ROSA)26Sortm4(ACTB-tdTomato,-EGFP)Luo/Jstock no. 007676 MGI:3716464 RRID:IMSR_JAX:007676 |
FVB/N background |
| Genetic reagent (Mus musculus) | Gli2lzki | Jackson Laboratory (Bai and Joyner, 2001) | Gli2tm2.1Alj/J stock no. 007922 MGI:3815004 RRID:IMSR_JAX:007922 |
SWR/J background |
| Antibody | Anti-ZO-1 (rat monoclonal) |
Developmental Studies Hybridoma Bank (DSHB) | R26.4C RRID:AB_2205518 |
(1:100) |
| Antibody | Anti-phospho-Histone H3 (rabbit polyclonal) |
Upstate | 06–570 RRID:AB_310177 |
(1:1000) |
| Antibody | Anti-Arl13b (rabbit polyclonal) |
Caspary et al., 2007 | (1:1000) | |
| Antibody | Anti-β-catenin (mouse monoclonal) |
BD | 610153 RRID:AB_397554 |
(1:300) |
| Antibody | Anti-laminin (rabbit polyclonal) |
Sigma | L9393 RRID:AB_477163 |
(1:1000) |
| Antibody | Anti-N-cadherin (rabbit monoclonal) |
Cell Signaling Technology | D4R1H RRID:AB_2687616 |
(1:500) |
| Antibody | Anti-GFP (chicken polyclonal) |
abcam | ab13970 RRID:AB_300798 |
(1:1000) |
| Antibody | Anti-Nkx6.1 (mouse monoclonal) |
DSHB | F55A10 RRID:AB_532378 |
(1:50) |
| Antibody | Anti-diphospho myosin regulatory light chain (rabbit polyclonal) |
Cell Signaling Technology | 3674 RRID:AB_2147464 |
(1:100) |
| Antibody | Anti-FoxA2 (rabbit monoclonal) |
abcam | ab108422 RRID:AB_11157157 |
(1:1000) |
| Sequence-based reagent | Ift122(TR2)_F | This study | PCR primer | CTGGTTGTAATCTGACTCGTTGA After amplification with below reverse primer, product is digested with HpyCH4III, resulting in a 133 bp WT band and a 118 bp mutant band. |
| Sequence-based reagent | Ift122(TR2)_R | This study | PCR primer | ACTCCCAAGCAAGCGAACT |
| Sequence-based reagent | Ttc21b(TF2)_F | This study | PCR primer | AGAATGATGTGCAACCTTGTTGA After amplification with below reverse primer, product is digested with NmuCI, resulting in a 224 bp WT band and a 168 bp mutant band. |
| Sequence-based reagent | Ttc21b(TF2)_R | This study | PCR primer | TTATCTGGCTCACGGTCTCC |
| Software, algorithm | SeedWater Segmenter | Mashburn et al., 2012 | ||
| Software, algorithm | SEGGA | Farrell et al., 2017 | ||
| Software, algorithm | FIJI/ImageJ |
Schindelin et al., 2012
Schneider et al., 2012 |
RRID:SCR_002285 | |
| Software, algorithm | MorphoLibJ (FIJI plugin) |
Legland et al., 2016 | ||
| Software, algorithm | ITK-SNAP | Yushkevich et al., 2006 | RRID:SCR_002010 | |
| Software, algorithm | R | R Development Core Team, 2020 | RRID:SCR_001905 | |
| Software, algorithm | Circular plugin (for R) | Agostinelli and Lund, 2017 | ||
| Software, algorithm | Prism | Graphpad | RRID:SCR_002798 | |
| Software, algorithm | Zen | Zeiss | RRID:SCR_018163 | |
| Software, algorithm | LAS X | Leica | RRID:SCR_013673 | |
| Software, algorithm | EOS Utility | Canon | ||
| Software, algorithm | Illustrator | Adobe | RRID:SCR_010279 |