REAGENT or RESOURCE	SOURCE	IDENTIFIER
Antibodies
Rabbit polyclonal p300 (discontinued) – ChIP	Santa Cruz Biotechnology	Cat# sc-585; RRID: AB_2231120
Rabbit polyclonal H3K4me1 – ChIP	Abcam	Cat# ab8895; RRID: AB_306847
Rabbit polyclonal H3K27ac – ChIP	Active Motif	Cat# 39133; RRID: AB_2561016
Rabbit polyclonal H3K4me3 – ChIP	Active Motif	Cat# 39159; RRID: AB_2615077
Rabbit polyclonal CTCF – ChIP	Cell Signaling	Cat# 2899; RRID: AB_2086794
Rabbit polyclonal RAD21 – ChIP	Abcam	Cat# ab992; RRID: AB_2176601
Mouse monoclonal TWIST1 – ChIP	Abcam	Cat# ab50887; RRID: AB_883294
Chemicals, Peptides, and Recombinant Proteins
mTeSR	Stem Cell Technologies	Cat# 85850
Matrigel Growth Factor Reduced (GFR) Basement Membrane Matrix	Corning	Cat# 356231
ReLeSR	Stem Cell Technologies	Cat# 05872
Collagenase IV	GIBCO	Cat# 17104019
DMEM/F12 1:1 medium, with L-glutamine; without HEPES	GE Healthcare	Cat# SH30271.FS
Neurobasal Medium	Thermo Fisher Scientific	Cat# 21103049
Gem21 NeuroPlex Supplement With Vitamin A	Gemini Bio-Products	Cat# 400-160
N2 NeuroPlex Supplement	Gemini Bio-Products	Cat# 400-163
Antibiotic-Antimycotic (100X)	GIBCO	Cat# 15240062
GlutaMAX Supplement (100X)	Life Technologies	Cat# 35050061
Recombinant Human FGF-basic (154 a.a.)	PeproTech	Cat# 100-18B
Animal-Free Recombinant Human EGF	Peprotech	Cat# AF-100-15
Bovine Insulin Powder	Gemini	Cat# 700-112P
Human Plasma Fibronectin Purified Protein	MilliporeSigma	Cat# FC01010MG
Accutase	Sigma-Aldrich	Cat# A6964-100ML
Bovine Serum Albumin (BSA), Fraction V—Serum Replacement Grade	Gemini Bio-Products	Cat# 700-104P
Recombinant Human/Murine/Rat BMP-2 (E.coli derived)	PeproTech	Cat# 120-02
CHIR-99021 (CT99021) HCl	Selleck Chemicals	Cat# S2924
DMEM/High glucose with L-glutamine, sodium pyruvate	Cytiva (formerly GE Healthcare)	Cat# SH30243.01
Corning ITS+ Premix Universal Culture Supplement	Corning	Cat# 354352
Sodium pyruvate	Life Technologies	Cat# 11360070
Ascorbic acid	Sigma-Aldrich	Cat# A4403-100MG
Dexamethasone	Thermo Fisher Scientific	Cat# AAA1759003
Recombinant Human TGF-β3	PeproTech	Cat# 100-36E
Y-27632 RHO/ROCK pathway inhibitor	Stem Cell Technologies	Cat# 72304
KnockOut DMEM	GIBCO	Cat# 10829018
Alcian Blue 8GX	Sigma-Aldrich	Cat# A3157-10G
cOmplete, EDTA-free Protease Inhibitor Cocktail	MilliporeSigma	Cat# 11873580001
Blasticidin (Solution), 100 mg	Invivogen	Cat# NC9016621
QuickExtract DNA Extraction Solution	Lucigen	QE09050
Bacterial and Virus Strains
Adeno-flippase (Ad5CMVFlpO)	Fred Hutchinson Cancer Research Center	VVC-U of Iowa-530 (MTA)
Critical Commercial Assays
NEBNext Ultra II DNA Library Prep Kit for Illumina	New England BioLabs	Cat# E7645S
SeqCap EZ Accessory Kit v2	Roche	Cat# 07145594001
SeqCap EZ Hybridization and Wash Kit	Roche	Cat# 05634261001
SeqCap EZ HE-Oligo Kit A	Roche	Cat# 06777287001
KAPA Library Quantification Kit Illumina platforms, qPCR Master Mix optimized for LightCycler 480	Kapa Biosystems	Cat# KK4854
TRIzol Reagent	Invitrogen	Cat# 15596018
FuGENE 6	Promega	Cat# E2691
NEBNext Multiplex Oligos for Illumina kit	New England BioLabs	Cat# E7335S
AMPure XP	Beckman Coulter	Cat# A63881
Dynabeads mRNA Purification Kit (for mRNA purification from total RNA preps)	Invitrogen	Cat# 61006
Dynabeads Protein G for Immunoprecipitation	Invitrogen	Cat# 10004D
NEBNext Multiplex Oligos for Illumina (Dual Index Primers Set 1)	New England BioLabs	Cat# E7600
Qubit dsDNA HS Assay Kit	Invitrogen	Cat# Q32854
SuperScript IV VILO Master Mix with ezDNase Enzyme	Invitrogen	Cat# 11766050
Dual-Luciferase Reporter Assay System	Promega	Cat# E1960
HiScribe T7 Quick High Yield RNA Synthesis Kit	New England BioLabs	Cat# E2050S
MEGAclear Transcription Clean-up kit	Ambion	Cat# AM1908
Deposited Data
ChIP-seq, ATAC-seq, RNA-seq and Capture-C data	This paper	GEO: GSE145327
H9 hESC 10X Genomics linked-read sequencing	This paper	Sequence Read Archive (SRA) BioProject: PRJNA648128
Experimental Models: Cell Lines
Human: Female H9 human embryonic stem cells (hESCs)	WiCell	WA09; RRID: CVCL_9773
Experimental Models: Organisms/Strains
Mouse: C57BL/6J	The Jackson Laboratory	RRID: IMSR_JAX:000664
Mouse: FVB/NJ	The Jackson Laboratory	RRID: IMSR_JAX:001800
Mouse: B6.Cg-E2f1Tg(Wnt1-cre)2Sor/J	The Jackson Laboratory (Lewis et al., 2013)	RRID: IMSR_JAX:022501
Mouse: B6.129S7-Sox9tm2Crm/J	The Jackson Laboratory (Akiyama et al., 2002)	RRID: IMSR_JAX:013106
Mouse: FVB-mEC1.45del-founder1	This paper	N/A
Mouse: FVB-mEC1.45del-founder2	This paper	N/A
Oligonucleotides
Primers for qRT-PCR, CRISPR-Cas9, LNA probes, see Table S5	This paper	N/A
RNA sequence: mEC1.45 upstream guide RNA1 (E1-45del_sg2U): AACAAGGTAGCGCCTCCTTA	This paper	N/A
RNA sequence: mEC1.45 downstream guide RNA1 (E1-45del_sg2D): ATATCAAGCACAAGGAGTGC	This paper	N/A
RNA sequence: mEC1.45 upstream guide RNA2 (CR50_sg3U): gatgttatggaaccttaagg	This paper	N/A
RNA sequence: mEC1.45 downstream guide RNA2 (CR53_sg3D): gaacaattacaaccaaacag	This paper	N/A
Recombinant DNA
Super piggyBac Transposase expression vector	System Biosciences (SBI)	Cat# PB210PA-1
Plasmid: pGL3-SV40_control	Promega	N/A
Plasmid: pRL	Promega	N/A
Plasmid: pGL3-noSV40-humanEC1.45	This paper	N/A
Plasmid: pGL3-noSV40-humanEC1.45_p300peak1	This paper	N/A
Plasmid: pGL3-noSV40-humanEC1.45_p300peak2	This paper	N/A
Plasmid: pGL3-noSV40-humanEC1.45_p300peak1-2	This paper	N/A
Plasmid: pGL3-noSV40-humanEC1.45_min1	This paper	N/A
Plasmid: pGL3-noSV40-humanEC1.45_min2	This paper	N/A
Plasmid: pGL3-noSV40-humanEC1.45_min1-2	This paper	N/A
Plasmid: pGL3-noSV40-humanEC1.35_S1-2	This paper	N/A
Plasmid: pGL3-noSV40-humanEC1.35_S1	This paper	N/A
Plasmid: pGL3-noSV40-humanEC1.35_S2	This paper	N/A
Plasmid: pGL3-noSV40-humanEC1.25_S3-4-5-6	This paper	N/A
Plasmid: pGL3-noSV40-humanEC1.25_S3	This paper	N/A
Plasmid: pGL3-noSV40-humanEC1.25_S4	This paper	N/A
Plasmid: pGL3-noSV40-humanEC1.25_S5	This paper	N/A
Plasmid: pGL3-noSV40-humanEC1.25_S6	This paper	N/A
Plasmid: pGL3-noSV40-humanCOL2A1enhancer	This paper	N/A
Plasmid: pGL3-noSV40-humanEC1.45_min1-2_4XCoordinatorMutant	This paper	N/A
Plasmid: pGL3-noSV40-humanEC1.45_min1-2_1XCoordinatorMutant	This paper	N/A
Plasmid: pGL3-noSV40-humanEC1.45_min1-2_3XCoordinatorMutant	This paper	N/A
Plasmid: pGL3-noSV40-EC1.45-human_min1-mouse_min2	This paper	N/A
Plasmid: pGL3-noSV40-EC1.45-human_min1-opossum_min2	This paper	N/A
Plasmid: pGL3-noSV40-EC1.45-human_min1-platypus_min2	This paper	N/A
Plasmid: pGL3-noSV40-EC1.45-human_min1-chicken_min2	This paper	N/A
Plasmid: pGL3-noSV40-EC1.45-human_min1-lizard_min2	This paper	N/A
Plasmid: pGL3-noSV40-EC1.45-human_min1-frog_min2	This paper	N/A
Plasmid: pGL3-noSV40-EC1.45-human_min1-coelacanth_min2	This paper	N/A
Plasmid: pGL3-noSV40-mouseEC1.45	This paper	N/A
Plasmid: pGL3-noSV40-humanEC1.45_p300peak1-2_del1	This paper	N/A
Plasmid: pGL3-noSV40-humanEC1.45_p300peak1-2_del2	This paper	N/A
Plasmid: pGL3-noSV40-humanEC1.45_p300peak1-2_del3	This paper	N/A
Plasmid: pGL3-noSV40-humanEC1.45_p300peak1-2_del4	This paper	N/A
Plasmid: pGL3-noSV40-humanEC1.45_p300peak1-2_del5	This paper	N/A
Plasmid: pGL3-noSV40-humanEC1.45_p300peak1-2_del6	This paper	N/A
Plasmid: pGL3-noSV40-humanEC1.45_p300peak1-2_del7	This paper	N/A
Plasmid: pGL3-noSV40-humanEC1.45_p300peak1-2_del8	This paper	N/A
Plasmid: pGL3-noSV40-humanEC1.45_p300peak1-2_del9	This paper	N/A
Plasmid: pGL3-noSV40-humanEC1.45_p300peak1-2_del10	This paper	N/A
Plasmid: pGL3-noSV40-humanEC1.45_p300peak1-2_del11	This paper	N/A
Plasmid: pGL3-noSV40-humanEC1.45_p300peak1-2_del12	This paper	N/A
Plasmid: pGL3-noSV40-humanEC1.45_p300peak1-2_CoordinatorMutant#1	This paper	N/A
Plasmid: pGL3-noSV40-humanEC1.45_p300peak1-2_CoordinatorMutant#2	This paper	N/A
Plasmid: pGL3-noSV40-humanEC1.45_p300peak1-2_CoordinatorMutant#3	This paper	N/A
Plasmid: pGL3-noSV40-humanEC1.45_p300peak1-2_CoordinatorMutant#4	This paper	N/A
Plasmid: pGL3-noSV40-humanEC1.45_p300peak1-2_CoordinatorMutant#5	This paper	N/A
Plasmid: pGL3-noSV40-humanEC1.45_p300peak1-2_CoordinatorMutant#6	This paper	N/A
Plasmid: pGL3-noSV40-humanEC1.45_p300peak1-2_CoordinatorMutant#7	This paper	N/A
Plasmid: pGL3-noSV40-humanEC1.45_p300peak1-2_4XCoordinatorMutant#1-2-3-4	This paper	N/A
Plasmid: pGL3-noSV40-humanEC1.45_p300peak1-2_3XCoordinatorMutant#5-6-7	This paper	N/A
Plasmid: pGL3-noSV40-humanEC1.45_p300peak1-2_7XCoordinatorMutant	This paper	N/A
Plasmid: pHsp68-LacZ-P2A-tdTomato-coreinsulator	This paper	N/A
Plasmid: pHsp68-LacZ-P2A-tdTomato-coreinsulator_humanEC1.45	This paper	N/A
Plasmid: pHsp68-LacZ-P2A-tdTomato-coreinsulator_humanEC1.35-S1-2	This paper	N/A
Plasmid: pHsp68-LacZ-P2A-tdTomato-coreinsulator_humanEC1.25-S3x3	This paper	N/A
Plasmid: pHsp68-LacZ-P2A-tdTomato-coreinsulator_humanEC1.25-S4x3	This paper	N/A
Plasmid: pHsp68-LacZ-P2A-tdTomato-coreinsulator_humanEC1.25-S5x3	This paper	N/A
Plasmid: pHsp68-LacZ-P2A-tdTomato-coreinsulator_humanEC1.25-S6x3	This paper	N/A
Plasmid: pHsp68-LacZ-P2A-tdTomato-coreinsulator_mouseEC1.45	This paper	N/A
Plasmid: pHsp68-LacZ-P2A-tdTomato-coreinsulator_mouseEC1.25-S3x3	This paper	N/A
Plasmid: pHsp68-LacZ-P2A-tdTomato-coreinsulator_mouseEC1.25-S5x3	This paper	N/A
Plasmid: pHsp68-LacZ-P2A-tdTomato-coreinsulator_mouseEC1.25-S6x3	This paper	N/A
Plasmid: Sox9 in situ plasmid	From Ian Welsh	N/A
Plasmid: pX458-dual-U6prom-sgRNA-EC1.45_CAGprom-Cas9-GFP	This paper	N/A
Plasmid: EC1.45-HAs_FRT-EF1a-mCherry-T2A-Blast-FRT-FRT3	This paper	N/A
Plasmid: pX458-U6prom-sgRNA-EC1.25_CAGprom-Cas9-GFP	This paper	N/A
Plasmid: EC1.25-firstDonor_HAs-hUbCprom-eGFP-tCD8	This paper	N/A
Plasmid: EC1.25-secondDonor_HAs_only	This paper	N/A
Software and Algorithms
CHOPCHOP	Labun et al., 2019	https://chopchop.cbu.uib.no/
Benchling	Benchling [Biology Software]. (2017)	https://www.benchling.com/
Bruker Recon software	Bruker	N/A
Amira software	ThermoFisher Scientific	https://www.thermofisher.com/us/en/home/industrial/electron-microscopy/electron-microscopy-instruments-workflow-solutions/3d-visualization-analysis-software/amira-life-sciences-biomedical.html
The R package for Statistical Computing	R Core Team (2019); R version 3.6.0	https://www.r-project.org/
R Geomorph package	Adams and Otárola-Castillo, 2013	https://cran.r-project.org/web/packages/geomorph/index.html
R hotelling.test function		https://cran.r-project.org/web/packages/Hotelling/Hotelling.pdf
skewer	Jiang et al., 2014	https://github.com/relipmoc/skewer
bowtie2	Langmead and Salzberg, 2012	http://bowtie-bio.sourceforge.net/bowtie2/index.shtml
bedtools	Quinlan and Hall, 2010	https://github.com/arq5x/bedtools2
bedgraphToBigWig		https://github.com/ENCODE-DCC/kentUtils
macs1.4	Zhang et al., 2008	https://github.com/macs3-project/MACS
cutadapt	Martin, 2011	https://cutadapt.readthedocs.io/en/stable/
HISAT2	Kim et al., 2019	https://daehwankimlab.github.io/hisat2/
featureCounts (subread package)	Liao et al., 2014	http://subread.sourceforge.net/
CapSequm2	Hughes et al., 2014	http://apps.molbiol.ox.ac.uk/CaptureC/cgi-bin/CapSequm.cgi
Long Ranger (longranger-2.2.2)	10X Genomics	https://support.10xgenomics.com/genome-exome/software/pipelines/latest/what-is-long-ranger
Macs2 (macs2 2.1.1.20160309)	Zhang et al., 2008	https://github.com/macs3-project/MACS
SeqPos (Cistrome Project)	Liu et al., 2011	http://cistrome.org/
ggseqlogo	Wagih, 2017	https://cran.r-project.org/web/packages/ggseqlogo/ggseqlogo.pdf
ggplot2	Wickham, 2016	https://ggplot2.tidyverse.org/
UCSC	Kent et al., 2002	https://genome.ucsc.edu/
Samtools (v1.3.1)	Li et al., 2009	http://samtools.sourceforge.net/
Bioanalyzer 2100 Expert Software	Agilent	https://www.agilent.com/en/product/automated-electrophoresis/bioanalyzer-systems/bioanalyzer-software/2100-expert-software-228259
QuantaSoft Software	BioRad	https://www.bio-rad.com/en-us/sku/1864011-quantasoft-software-regulatory-edition?ID=1864011
Other
Leica imaging stereoscope	Leica	N/A
Covaris sonicator E220	Covaris	N/A
Bruker Skyscan 1276 MicroCT (purchased with an NIH S10 Shared Instrumentation Grant, 1S10OD02349701, PI Timothy C. Doyle)	Bruker	https://www.bruker.com/products/microtomography/in-vivo-micro/skyscan-1276/overview.html
Veritas Microplate Luminometer	Turner Biosystems	N/A
Leica M205 FA Stereo Microscope coupled to a Leica DFC7000T digital camera	Leica	N/A
Leica MZ16 microscope coupled to a Leica DFC420 digital camera	Leica	N/A
QX200 Droplet Generator	BioRad	https://www.bio-rad.com/en-gu/sku/1864002-qx200-droplet-generator?ID=1864002
QX200 Droplet Reader	BioRad	https://www.bio-rad.com/en-us/sku/1864003-qx200-droplet-reader?ID=1864003
Chromium controller	10X Genomics	https://www.10xgenomics.com/instruments/chromium-controller/
HiSeq4000 (purchased with funds from NIH under award number S10OD018220)	Illumina	N/A
NextSeq500	Illumina	N/A
Amaxa 4D nucleofector	Lonza	https://bioscience.lonza.com/lonza_bs/US/en/Transfection/p/000000000000203684/4D-Nucleofector-Core-Unit
A&D Weighing EJ-120 Newton Portable Balance, 120 g x 0.01 g; 115V	A&D Weighing	N/A
LightCycler 480	Roche	N/A
High Resolution Episcopic Microscope	Tim Mohun lab	N/A
Bioanalyzer	Agilent	https://www.agilent.com/en/product/automated-electrophoresis/bioanalyzer-systems/bioanalyzer-instrument/2100-bioanalyzer-instrument-228250