| Antibodies |
| CD45-FITC |
BD Biosciences |
Cat# 564585; RRID:AB_2732068 |
| CD3-PeCy7 |
BD Biosciences |
Cat# 557749; RRID:AB_396855 |
| CD19-Pe |
BD Biosciences |
Cat# 555413; RRID:AB_395813 |
| Cell ROX deep red |
Thermo Fisher |
Cat# C10422; RRID: N/A |
| CD34-PeCy7 |
BD Biosciences |
Cat# 560710; RRID: AB_1727470 |
| NAMPT |
Invitrogen |
Cat# PA5-23198; RRID:AB_2540724 |
| GAPDH |
Santa Cruz |
Cat#sc-32233; RRID:AB_627679 |
| Biological Samples |
|
|
| Human acute myeloid leukemia specimens |
University of Colorado Hematologic Malignancies Tissue Bank |
N/A |
| Chemicals, Peptides, and Recombinant Proteins |
| Amino Acids |
Carolina |
Cat# 84-3700; RRID: N/A |
| Human SCF |
PEPROtect |
Cat# 300-07; RRID: N/A |
| Human IL3 |
PEPROtect |
Cat# 200-03; RRID: N/A |
| Human FLT3 |
PEPROtect |
Cat# 300-19; RRID: N/A |
| Low Density lipoprotein |
Millipore |
Cat# 437744; RRID: N/A |
| BIT9500 Serum Substitute |
Stem Cell Technology |
Cat# 09500; RRID: N/A |
|
13C,15N-labeled amino acids |
Cambridge Isotope Laboratories |
Cat# MSK-A2-US-1.2; RRID: N/A |
|
13C6 glucose |
Sigma-Aldrich |
Cat# 389374; RRID: N/A |
|
13C16 palmitic acid |
Sigma-Aldrich |
Cat# 705573; RRID: N/A |
| nicotinamide (2,6,CARBONYL-13C3; RING-1-15N) |
Cambridge Isotopes |
Cat#CNLM-9757; RRID: N/A |
|
13C11,15N2tryptophan |
Sigma-Aldrich |
Cat#574597; RRID: N/A |
| Cell-Tak |
Corning |
Cat# 324240; RRID: N/A |
| Human methylcellulose |
R&D systems |
Cat# HSC003; RRID: N/A |
| APO866 |
SelleckChem |
Cat# S2799; RRID N/A |
| KPT-9274 |
Karyopharm |
N/A |
| Oligomycin |
Sigma-Aldrich |
Cat# 871744; RRID: N/A |
| FCCP |
Sigma-Aldrich |
Cat# C2920; RRID: N/A |
| Antimycin A |
Sigma-Aldrich |
Cat# A8774; RRID: N/A |
| Rotenone |
Sigma-Aldrich |
Cat# R8875; RRID: N/A |
| NAMPT siRNA |
Dharmacon |
Cat# L-004581-00-0005; RRID: N/A |
| HADH siRNA |
Dharmacon |
Cat# L-008298-00-0005; RRID: N/A |
| Scrambled siRNA |
Dharmacon |
Cat# D-001810-01-05; RRID: N/A |
| Critical Commercial Assays |
| XF96 extracellular flux assay kits |
Agilent Technologies |
Cat# 102417-100; RRID: N/A |
| α-ketoglutarate dehydrogenase assay |
Abcam |
Cat# ab83431; RRID: N/A |
| malate dehydrogenase assay |
Abcam |
Cat# ab119693; RRID: N/A |
| Isocitrate dehydrogenase assay |
Abcam |
Cat# ab102528; ab102528 |
| Hexokinase activity assay |
Abcam |
Cat# ab136957; ab102528 |
| NAD/NADH Glo |
Promega |
Cat# 9071; RRID: N/A |
| Neon Transfection System |
Thermo Scientific |
N/A |
| Neon™ Transfection System Starter Pack |
Thermo Scientific |
Cat#MPK5000S; RRID: N/A |
| RNeasy Plus Mini Kit |
Qiagen |
Cat# 74136; RRID: N/A |
| iSCRIPT cDNA Synthesis |
Biorad |
Cat# 1708890; RRID: N/A |
| Experimental Models: Organisms/Strains |
| NOD.Cg-Prkdcscid Il2rgtm1Wjl Tg(CMV-IL3,CSF2,KITLG)1Eav/MloySzJ |
The Jackson Laboratory |
Cat# JAX:013062, RRID:IMSR_JAX:013062 |
| Oligonucleotides |
| NAMPT Forward: gttcctgagggctttgtcat |
This paper |
N/A |
| NAMPT Reverse: ggccactgtgattggatacc |
This paper |
N/A |
| GAPDH Forward: cagcaagagcacaagaggaa |
This paper |
N/A |
| GAPDH Reverse: gtgggggactgagtgtgg |
This paper |
N/A |
| Software and Algorithms |
| Flowjo |
Flowjo |
N/A |
| Metaboanalyst |
http://www.metaboanalyst.ca/ |
N/A |
| Morpheus |
https://software.broadinstitute.org/morpheus/ |
N/A |
| Maven |
http://genomics-pubs.princeton.edu/mzroll/index.php |
N/A |
