Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.
Sequences of primers
| Primer | Sequence (5′–3′) |
|---|---|
| CRTC1A (outer) | tcgcgctgcacaatcagaag |
| CRTC1Ba (inner) | gaggtcatgaaggacctgag |
| CRTC3A (outer) | tcgcgctgcacacgcagaga |
| CRTC3B (inner) | cagagacaggccgaggagac |
| MAML2A (outer) | ggtcgcttgctgttggcagg |
| MAML2Ba (inner) | ttgctgttggcaggagatag |
Primers used for quantitative RT‐PCR. CRTC 1, cAMP response element‐binding protein (CREB)‐regulated transcription coactivator 1 (CRTC1); MAML2, mastermind‐like gene 2.
