Table 2.
Summary of miRNAs associated with rheumatoid arthritis (RA) mentioned in Section 2.
| miRNA | Other Names | Sequence | Ref. (Optical Sensors) | Ref. (RA) |
|---|---|---|---|---|
| hsa-miR-21-5p | hsa-miR-21 | UAGCUUAUCAGACUGAUGUUGA | [37,38,39,40,41,42,43,44,45,46,47,48,49,54,55,56,61,63,64,65,66,67,68,71], [52,70,72] (c), [59] (c),(d) |
[21,23,24] |
| hsa-let-7a-5p | hsa-let-7a | UGAGGUAGUAGGUUGUAUAGUU | [50,51,52,53,57,58,68,69,70], [39,43,61] (c) | [73,74] |
| hsa-let-7b-5p (a) | hsa-let-7b | UGAGGUAGUAGGUUGUGUGGUU (2) | [61], [39,43,51,52,53,57,58,65,69] (c) | [75] |
| hsa-let-7c-5p (a),(b) | - | UGAGGUAGUAGGUUGUAUGGUU (1) | [65], [39,43,50,52,57,58,61,68,69] (c) | [76] |
| hsa-miR-9-5p | hsa-miR-9 | UCUUUGGUUAUCUAGCUGUAUGA | [57] | [77,78] |
| hsa-miR-15a-5p | hsa-miR-15a | UAGCAGCACAUAAUGGUUUGUG | [62] | [21] |
| hsa-miR-16-5p | hsa-miR-16 | UAGCAGCACGUAAAUAUUGGCG | [56,57,67,70], [64] (c) | [21,22,79] |
| hsa-miR-24-3p | hsa-miR-24 | UGGCUCAGUUCAGCAGGAACAG | [65,67], [70] (c) | [35] |
| hsa-miR-26a-5p | hsa-miR-26a | UUCAAGUAAUCCAGGAUAGGCU | [66,67], [40] (c) | [35,74] |
| hsa-miR-29a-3p | hsa-miR-29a | UAGCACCAUCUGAAAUCGGUUA | [66] | [80] |
| hsa-miR-31-5p | hsa-miR-31 | AGGCAAGAUGCUGGCAUAGCU | [56,71] | [22] |
| hsa-miR-106a-5p | hsa-miR-106a | AAAAGUGCUUACAGUGCAGGUAG | [66] | [81] |
| hsa-miR-125a-5p | hsa-miR-125a | UCCCUGAGACCCUUUAACCUGUGA | [58] | [35] |
| hsa-miR-126-3p | hsa-miR-126 | UCGUACCGUGAGUAAUAAUGCG | [59] (d) | [35] |
| hsa-miR-133a-3p | - | UUUGGUCCCCUUCAACCAGCUG | [70] | [82] |
| hsa-miR-133b | - | UUUGGUCCCCUUCAACCAGCUA | [65] | [35] |
| hsa-miR-141-3p | hsa-miR-141 | UAACACUGUCUGGUAAAGAUGG | [54,71], [38,61,64,72] (c), [59] (c),(d) | [83] |
| hsa-miR-155-5p | hsa-miR-155 | UUAAUGCUAAUCGUGAUAGGGGUU | [56,60,63,72], [44] (c) | [21,84] |
| hsa-miR-222-3p | hsa-miR-222 | AGCUACAUCUGGCUACUGGGU | [66] | [85] |
| hsa-miR-335-5p | hsa-miR-335 | UCAAGAGCAAUAACGAAAAAUGU | [66] | [86] |
(a) These miRNAs are part of the let-7 family and are commonly used in specificity assays where the target miRNA is let-7a. For that reason, in their sequences, the bases in which they differ from let-7a are underlined and the total number of different bases is written between parentheses.; (b) Let-7c-5p is commonly referred to as let-7c in the articles included in this review. However, based on [36] and after checking that the miRNA sequences were the same, it has been considered more correct to use the name let-7c-5p.; (c) The miRNA appears in the corresponding article, but used only in a specificity assay.; (d) The complementary sequence of the corresponding miRNA is used.