Table 3.
Summary of miRNAs only employed in specificity assays.
| miRNA (a) | Other Names | Sequence | Ref (Optical Sensors) |
|---|---|---|---|
| hsa-let-7d-5p (b) | hsa-let-7d | AGAGGUAGUAGGUUGCAUAGUU (2) | [57,58], [59] (d) |
| hsa-let-7e-5p (b) | hsa-let-7e | UGAGGUAGGAGGUUGUAUAGUU (1) | [38,50,51,53,61] |
| hsa-let-7f-5p (b) | hsa-let-7f | UGAGGUAGUAGAUUGUAUAGUU (1) | [50,51,53] |
| hsa-let-7g-5p (b) | hsa-let-7g | UGAGGUAGUAGUUUGUACAGUU (2) | [51,53] |
| hsa-let-7i-5p (b) | hsa-let-7i | UGAGGUAGUAGUUUGUGCUGUU (4) | [38,51,53] |
| hsa-miR-122-5p | hsa-miR-122a, hsa-miR-122 |
UGGAGUGUGACAAUGGUGUUUG | [40,64,68], [59] (d) |
| hsa-miR-126-5p | hsa-miR-126* | CAUUAUUACUUUUGGUACGCG | [41,64] |
| hsa-miR-141-5p | hsa-miR-141* | CAUCUUCCAGUACAGUGUUGGA | [40] |
| hsa-miR-143-3p | hsa-miR-143 | UGAGAUGAAGCACUGUAGCUC | [61] |
| hsa-miR-200b-3p | hsa-miR-200b | UAAUACUGCCUGGUAAUGAUGA | [54] |
| hsa-miR-210-3p (c) | - | CUGUGCGUGUGACAGCGGCUGA | [45,48,49,55] |
| hsa-miR-214-3p | hsa-miR-214 | ACAGCAGGCACAGACAGGCAGU | [42,45,48,49,55] |
| hsa-miR-429 | - | UAAUACUGUCUGGUAAAACCGU | [54] |
(a) If a miRNA is in this table, it does not necessarily mean that it is not connected with RA. It means that, in the articles included in this review, it is only used as a control in specificity assays. For instance, let-7e [22], let-7g [88], miR-143 [89,90], and miR-210 [91,92] (it is not clear if these references mention miR-210-3p or miR-210-5p) are linked with RA. Although both miR-143 and miR-210-3p are detected in [57], they are not studied in depth, so they have not been included in Table 2; (b) These miRNAs are part of the let-7 family and are commonly used in specificity assays where the target miRNA is let-7a. For that reason, in their sequences, the bases in which they differ from let-7a are underlined and the total number of different bases is written between parentheses.; (c) MiR-210-3p is commonly referred to as miR-210 in the articles included in this review. However, based on [36] and after checking that the miRNA sequences were the same, it has been considered more correct to use the name miR-210-3p.; (d) The complementary sequence of the corresponding miRNA is used.