Key resources table.
| Reagent type (species) or resource |
Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Strain, strain background (mouse) | Gtpbp1 < tm1Ynim/tm1Ynim> | Senju et al., 2000 | RRID:MGI:3036546 | Gtpbp1-/- strain (mixed genetic background) |
| Strain, strain background (mouse) | B6J.Gtpbp1<tm1Ynim/tm1Ynim> | This study | MGI:6467940 | B6J.Gtpbp1-/- strain (congenic background, C57BL/6J) |
| Strain, strain background (mouse) | B6J-Gtpbp2-/-(C57BL/6J-Gtpbp2nmf205/J) | Ishimura et al., 2014 | RRID:IMSR_JAX:004823 | |
| Strain, strain background (mouse) | B6J.Gcn2-/-(B6.129S6-Eif2ak4tm1.2Dron) | The Jackson Laboratory | RRID:IMSR_JAX:008240 | |
| Sequence-based reagent | Genotyping wild type allele Gtpbp1 | This study | N/A | Forward Primer: 5’GAGTACGGGCTGAGTGAAGC3’; Reverse Primer:5’TGGACAGGAACCTGATGTGA3’ |
| Sequence-based reagent | Genotyping mutant allele Gtpbp1 | This study | N/A | Forward Primer: 5’TACGCCACCGTGAAGAGCAT3’; Reverse Primer:5’AGGGGAGGAGTGGAAGGTGG3’ |
| Sequence-based reagent | Quantitative RT-PCR (beta actin) | This study | N/A | Forward Primer: 5’GGCTGTATTCCCCTCCATCG3’; Reverse Primer:5’ CCAGTTGGTAACAATGCCATGT3’ |
| Sequence-based reagent | RNAscope probe Gtpbp2 (mouse) | Advanced Cell Diagnostics | #527461 | |
| Sequence-based reagent | RNAscope probe Gtpbp1 (mouse) | Advanced Cell Diagnostics | #527451-C3 | |
| Sequence-based reagent | RNAscope probe Sesn2 (mouse) | Advanced Cell Diagnostics | Probe (reference number: 574751-C2) was modified for this study to be compatible with manual RNAscope protocol but is otherwise equivalent to #574758-C2 | |
| Sequence-based reagent | RNAscope probe Slc7a1 (mouse) | Advanced Cell Diagnostics | #461021 | |
| Sequence-based reagent | RNAscope probe Ddr2 (mouse) | Advanced Cell Diagnostics | #405991-C2 | |
| Sequence-based reagent | RNAscope probe Chac1 (mouse) | Advanced Cell Diagnostics | #514501 | |
| Commercial assay or kit | RNAscope Multiplex Fluorescent Reagent Kit v2 | Advanced Cell Diagnostics | #323100 | |
| Commercial assay or kit | TSA Plus Cyanine 5 | PerkinElmer | NEL745001KT | (1:1000) |
| Commercial assay or kit | TSA Plus Cyanine 3 | PerkinElmer | NEL744001KT | (1:2000) |
| Commercial assay or kit | DNA-free DNA Removal Kit | Life Technologies | AM1906 | |
| Commercial assay or kit | SuperScript III First-Strand Synthesis System | Invitrogen | #18080051 | |
| Commercial assay or kit | iQ SYBR Green Supermix | Bio-Rad | #1708880 | |
| Commercial assay or kit | TruSeq v2 mRNA kit | Illumina | RS-122–2001 | |
| Chemical compound, drug | Rapamycin | LC Laboratories | R5000 | |
| Antibody | Rabbit anti-phospho-EIF2alpha (polyclonal) | Cell Signaling Technology | CST #9721; RRID:AB_330951 | WB (1:1000) |
| Antibody | Rabbit anti- EIF2alpha (polyclonal) | Cell Signaling Technology |
CST #9722; RRID:AB_2230924 | WB (1:2000) |
| Antibody | Rabbit anti-phospho S6 ribosomal protein, S240/244(polyclonal) | Cell Signaling Technology | CST #5364; RRID:AB_10694233 | WB (1:4000) IF (1:1000) |
| Antibody | Mouse anti-S6 ribosomal protein (monoclonal) | Santa Cruz Biotechnology | sc-74459; RRID:AB_1129205 | WB (1:2000) IF (1:500) |
| Antibody | Mouse anti-Vinculin (monoclonal) | Sigma | V9131; RRID:AB_477629 | WB (1:20000) |
| Software, algorithm | GraphPad Prism 7 | GraphPad software | RRID:SCR_002798 | |
| Software, algorithm | kallisto v0.42.4 | Bray et al., 2016 | RRID:SCR_016582; https://pachterlab.github.io/kallisto/about | |
| Software, algorithm | sleuth v0.30.0 | Pimentel et al., 2017 | RRID:SCR_016883; https://pachterlab.github.io/sleuth/about | |
| Software, algorithm | featureCounts | Liao et al., 2014 | RRID:SCR_012919; http://bioinf.wehi.edu.au/featureCounts | |
| Software, algorithm | hisat2 v2.1.0 | Kim et al., 2019 | RRID:SCR_015530; https://daehwankimlab.github.io/hisat2/ | |
| Software, algorithm | fastx_clipper | Hannon Lab | http://hannonlab.cshl.edu/fastx_toolkit/ | |
| Software, algorithm | fastx_trimmer | Hannon Lab | http://hannonlab.cshl.edu/fastx_toolkit/ | |
| Software, algorithm | bowtie2 v 2.2.3 | Langmead and Salzberg, 2012 | RRID:SCR_005476; http://bowtie-bio.sourceforge.net/bowtie2/index.shtml | |
| Software, algorithm | RiboWaltz v1.0.1 | Lauria et al., 2018 | RRID:SCR_016948; https://github.com/LabTranslationalArchitectomics/RiboWaltz | |
| Software, algorithm | DESeq2 v1.22.2 | Love et al., 2014 | RRID:SCR_015687; https://bioconductor.org/packages/release/bioc/html/DESeq2.html | |
| Software, algorithm | riborex v2.3.4 | Li et al., 2017 | RRID:SCR_019104; https://github.com/smithlabcode/riborex | |
| Software, algorithm | ensembldb v2.6.8 | Rainer et al., 2019 | RRID:SCR_019103; https://www.bioconductor.org/packages/release/bioc/html/ensembldb.html | |
| Software, algorithm |
Pause site identification algorithm | Ishimura et al., 2014 | N/A | |
| Software, algorithm | Ingenuity Pathway Analysis (IPA) | QIAGEN, Inc | RRID:SCR_008653; https://www.qiagenbioinformatics.com/products/ingenuity-pathway-analysis | |
| Software, algorithm | DAVID bioinformatics web server | Huang et al., 2009 | RRID:SCR_001881; http://david.abcc.ncifcrf.gov |