KEY RESOURCES TABLE
REAGENT or RESOURCE | SOURCE | IDENTIFIER |
---|---|---|
Antibodies | ||
Rabbit anti-Fn14 | Cell Signaling Technology | Cat # 4403S; RRID:AB_10693941 |
Guinea Pig anti-VGLUT2 | Millipore | Cat # AB2251; RRID:AB_2665454 |
Rabbit anti-Iba-1 | Wako | Cat # 019-19741; RRID:AB_839504 |
Rabbit anti-P2ry12 | Sigma | Cat # HPA013796; RRID:AB_1854884 |
Goat anti-TWEAK | R&D Systems | Cat # AF1237; RRID:AB_2206219 |
Rabbit anti-GAPDH | Sigma-Aldrich | Cat # G9545; RRID:AB_796208 |
Mouse anti-PSD95 | In-house | Cheadle et al, 2018 |
Chicken anti-MAP2 | Lifespan Biosciences | Cat # LS-C61805; RRID:AB_1509808 |
Rabbit anti-GFAP | Abcam | Cat # ab4674; RRID:AB_304558 |
Goat anti-guinea pig AlexaFluor 647 | Molecular Probes | Cat # A-21450; RRID:AB_141882 |
Goat anti-rabbit AlexaFluor 488 | Thermo Fisher | Cat # A-11001; RRID:AB_2534069 |
Goat anti-mouse AlexaFluor 555 | Thermo Fisher | Cat # A-21428; RRID:AB_2535849 |
Donkey anti-goat AlexaFluor 488 | Thermo Fisher | Cat # A-11055; RRID:AB_2534102 |
Goat anti-guinea pig AlexaFluor 488 | Molecular Probes | Cat # A-11073; RRID:AB_2534117 |
Goat anti-rabbit Complete IRdye 800 CW | Li-Cor biosciences | Cat # 827–08365; RRID:AB_10796098 |
Bacterial and Virus Strains | ||
N/A | ||
Biological Samples | ||
N/A | ||
Chemicals, Peptides, and Recombinant Proteins | ||
DAPI Fluoromount-G | Southern Biotech | Cat # 0100-20 |
NuPAGE LDS Sample Buffer (4X) | Novex | Ref # NP0007 |
Syn-PER synaptic protein extraction reagent | Thermo Fisher | Cat # 87793 |
Paraformaldehyde, 16% | Electron Microscopy Sciences | Cat # 15710 |
Protein A dynabeads | Life Technologies | Cat # 10002D |
Triton X-100 | Sigma-Aldrich | Cat # X100 |
Trizol | Life Technologies | Ref # 15596026 |
Choleratoxin-B conjugated to 488 | Life Technologies | Cat # C34775 |
Choleratoxin-B conjugated to 555 | Life Technologies | Cat # C34776 |
Lipofectamine 2000 | Life Technologies | Cat # 11668500 |
Critical Commercial Assays | ||
FD Rapid Golgistain kit | FD NeuroTechnologies, Inc. | Cat #PK401A |
PowerUp SYBR Green Master Mix | Life Technologies | Cat #A25743 |
RNAscope Multiplexed Fluorescence Detection kit | ACDBio | Cat #320850 |
RNeasy Micro Kit | Qiagen | Cat #74004 |
RNAscope Multiplex Fluorescent Reagent Kit v2 | ACDBio | Cat #323100 |
Mouse TWEAK DuoSet ELISA | R&D Systems | Cat #DY1237 |
BCA protein assay | Thermo Fisher | Cat # 23225 |
Silverquest Silver Staining kit | Thermo Fisher | Cat # LC6070 |
Western Lightning ECL Pro | Perkin-Elmer | Cat # NEL121001EA |
Deposited Data | ||
N/A | ||
Experimental Models: Cell Lines | ||
N/A | ||
Experimental Models: Organisms/Strains | ||
Mouse: C57BL/6J | The Jackson Laboratory | 000664; RRID:IMSR_JAX:000664 |
Mouse: B6.Tnfrsf12atm1(KO)Biogen (Fn14 KO) | Jakubowski et al, 2005 | N/A |
Mouse: B6.Tnfsf12tm1(KO)Biogen | Dohi et al, 2009 | N/A |
Mouse: B6.Tnfrsf12a(fl/fl)Biogen | This paper | N/A |
Mouse: B6.Tnfsf12(fl/fl)Gree/J | This paper | N/A |
Mouse: B6.129P2(Cg)-Cx3cr1tm1Litt/J | The Jackson Laboratory | 005582; RRID:IMSR_JAX:005582 |
Mouse: Slc17a6tm2(cre)Lowl/J | The Jackson Laboratory | 028863; RRID:IMSR_JAX:016963 |
Mouse: Tg(Prkcd-glc-1/CFP,-Cre) | Haubensak et al, 2010 | N/A |
Mouse: B6.Cg-Gt(ROSA)26Sortm14(CAG-tdTomato)Hze/J | The Jackson Laboratory | 007914; RRID:IMSR_JAX:007914 |
Mouse: Tg(Chx10-EGFP/cre,-ALPP)2Clc/J | The Jackson Laboratory | 005105; RRID:IMSR_JAX:005105 |
Mouse: B6J.B6N(Cg)-Cx3cr1tm1.1(cre)Jung/J | The Jackson Laboratory | 025524; RRID:IMSR_JAX:025524 |
Mouse: B6.C1qa(KO) | Lab of Beth Stevens | N/A |
Oligonucleotides | ||
qPCR primer: Gapdh (Forward): GGGTGTGAACCACGAGAAATA | Origene | Cat #: MP205604 |
qPCR primer: Gapdh (Reverse): CTGTGGTCATGAGCCCTTC | Origene | Cat #: MP205604 |
qPCR primer: Tnfsf12 (TWEAK) (Forward): GCTGGGCAACGCTGTCT | Biogen | N/A |
qPCR primer: Tnfsf12 (TWEAK) (Reverse): GCGGTCCTCTGCTGTCA | Biogen | N/A |
qPCR: Cx3cr1 (Forward): GAGCATCACTGACATCTACCTCC | Origene | Cat #: MP202408 |
qPCR: Cx3cr1 (Reverse): AGAAGGCAGTCGTGAGCTTGCA | Origene | Cat #: MP202408 |
qPCR: P2ry12 (Forward): CATTGACCGCTACCTGAAGACC | Origene | Cat #: MP212229 |
qPCR: P2ry12 (Reverse): GCCTCCTGTTGGTGAGAATCATG | Origene | Cat #: MP212229 |
Recombinant DNA | ||
AAV9-CASI-sTWEAK | Biogen | N/A |
AAV9-CASI-mCherry | Biogen | N/A |
pCAG-mCherry | In-house | N/A |
Software and Algorithms | ||
ImageJ | NIH | https://fiji.sc/ or https://imagej.nih.gov/ij/ |
Prism | Graphpad | version 7.0b; RRID:SCR_002798 |
Neurolucida | Microbrightfield | RRID:SCR_001775 |
Imaris | Bitplane | ImarisColoc |
Metamorph | Molecular Devices | Version 1.0 |
Odyssey infrared imaging system | Li-Cor biosciences | Version 3.0 |
CATMAID | Saalfeld et al., 2009 | https://catmaid.readthedocs.io/en/stable/ |
iTK-SNAP | Yushkevich et al., 2006 | http://www.itksnap.org/pmwiki/pmwiki.php |
AlignTK | N/A | http://mmbios.org/installation |
STRING | Szklarczyk et al., 2019 | https://string-db.org/ |
Other | ||
FISH probe: C1qa, Channel 3 | ACDBio | Cat # 441221-C3 |
FISH probe: Cx3cr1, Channel 2 | ACDBio | Cat # 314221-C2 |
FISH probe: Olig1, Channel 3 | ACDBio | Cat # 480651-C3 |
FISH probe: Aldh1l1, Channel 2 | ACDBio | Cat # 405891-C2 |
FISH probe: Cldn5, Channel 3 | ACDBio | Cat # 491611-C3 |
FISH probe: Tnfrsf12a (Fn14), Channel 3 | ACDBio | Cat # 505311-C3 |
FISH probe: P2ry12, Channel 2 | ACDBio | Cat # 317601-C2 |
FISH probe: Vglut2, Channel 2 | ACDBio | Cat # 319171-C2 |
FISH probe: Tnfsf12 (TWEAK), Channel 1 | ACDBio | Cat # 552051 |
FISH probe: Aldoc, Channel 3 | ACDBio | Cat # 429531-C3 |