Table 2.

qPCR primers for Daphnia magna clock genes.

Gene	Abbreviation	Primer forward (5′-3′)	Primer reverse (5′-3′)	Tmelt	Amplicon size (bp)	Gene origin
Clock	clk	tccttttgaagttctcgggaca	gcttcatgacaggtagaaactttc	60 °C	80	scaffold00547
Cycle	cyc	ttttattcgtcgtgggctgc	aataattgagcacttgagacaccg	60 °C	75	scaffold03242
Cryptochrome 2	cry2	tgctactagacgcagattggtc	actttcctgccaaatctgacag	60 °C	115	scaffold00687
Timeless	tim	tccgcatcattggctacact	cgatggctgtgattactgatgc	60 °C	111	scaffold03376
Period	per	cggccggaattcaacagatg	tgctcggcttccatttctgt	60 °C	117	scaffold02670
Bruchpilot	brp	cacaacgatggcgttcacgtatt	gtcttctcagccacttctgacgt	56 °C	149	Dm_Bassoon
Tata-box binding protein	tbp	gcagggaagtttagtttctgga	tggtatgcacaggagcaaag	60 °C	88	Heckmann et al. 2006

Listed are gene names, abbreviations, primer sequences, melting temperature (T_melt), amplicon sizes and the origin of D. magna sequences for which D. pulex sequences (for gene IDs see Schwarzenberger & Wacker 2015) were blasted against the D. magna genome v.2.4 (wfleabase.org). Delineated are the scaffolds on which the blast hits were positioned. Tata-box binding protein (Heckmann et al. 2006) was used as reference based on result obtained from RefFinder³⁸.