Skip to main content
. 2020 Oct 12;1(6):612–621. doi: 10.1002/nano.202000125

TABLE 1.

Representative antiviral siRNA data from Chinese patent CN101173275, CN1648249, and US patent US20050004063

Patent siRNA Sequence Target region/gene
CN101173275 siRNA‐M1 5′‐GGGUGACUGGCGGGAUUGCGAU‐3 460‐480 bp
siRNA‐M2 5′‐GGGCGCUGUGACAUUAAGGAC‐3
CN1648249 8* 5′‐CGUCGCAGCGUGUAGGCACUA‐3′ M protein gene
51* 5′‐AACGGUUUACGUCUACUCGCA‐3′ N protein gene
56* 5′‐AACGUACUGCCACAAAACAGC‐3′ E protein gene
US20050004063 SARSi‐1 5′‐GUGAACUCACUCGUGAGCUCTT‐3′ 512‐531 bp of replicase A1 region
SARSi‐2 5′‐GUACCCUCUUGAUUGCAUCTT‐3′ 586‐604 bp of replicase A1 region
SARSi‐3 5′‐GAGUCGAAGAGAGGUGUCUTT‐3′ 916‐934 bp of replicase A1 region
SARSi‐4 5′‐GCACUUGUCUACCUUGAUGTT‐3′ 1194‐1213 of replicase A1 region
SARSi‐5 5′‐CCUCCAGAUGAGGAAGAAGTT‐3′ 3028‐3046 bp of replicase A region
SARSi‐6 5′‐GGUGUUUCCAUUCCAUGUGTT‐3′ 5024‐5042 bp of replicase A region